BBa_K1077000 1 fimIRL fim switch inverted repeat left IRL natural 2013-09-15T11:00:00Z 2015-05-08T01:09:03Z Synthesized based on E. coli CFT073 genomic sequence. fim switch inverted repeat left IRL natural. Ligate a part downstream, then ligate the IRR downstream of that. This switch half is in the "ON" orientation. false false _1386_ 0 13249 9 It's complicated true This switch half is in the "ON" orientation. false Mike Ferguson and Joshua Abramson BBa_K1077005 1 engfimS J23100 fim switch ON orientation 2013-09-15T11:00:00Z 2015-05-08T01:09:03Z none none false false _1386_ 0 13249 9 It's complicated true none false Mike Ferguson and Joshua Abramson component2348103 1 BBa_J23100 component2348102 1 BBa_K1077000 component2348104 1 BBa_K1077001 annotation2348102 1 BBa_K1077000 range2348102 1 1 291 annotation2348103 1 BBa_J23100 range2348103 1 300 334 annotation2348104 1 BBa_K1077001 range2348104 1 343 379 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1077001 1 fimIRR fim switch inverted repeat right IRR natural 2013-09-15T11:00:00Z 2015-05-08T01:09:03Z Synthesized based on E. coli CFT073 genomic sequence fim switch inverted repeat right IRR natural. Ligate a part upstream, then ligate the IRL upstream of that. This switch half is in the "ON" orientation. false false _1386_ 0 13249 9 It's complicated true This switch half is in the "ON" orientation. false Mike Ferguson and Joshua Abramson BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_K1077001_sequence 1 gatatagacagtttggccccaaatgtttcatcttttg BBa_K1077005_sequence 1 gatttaacttattgataataaagttaaaaaacaaataaatacaagacaattggggccattttgactcatagaggaaagcatcgcgcacaaactttttcagtttatttgttggcttaatgttctatagttatctttatttgcagttttttatattgcatgaggtggtttttggagagaagaatgaggaagttgcgtcgagctacagaaacgttagctttacatatagcggaggtgatgtgaaattaatttacaagagaaataatttacatatcaaacagttagatgcttttttactagagttgacggctagctcagtcctaggtacagtgctagctactagaggatatagacagtttggccccaaatgtttcatcttttg BBa_K1077000_sequence 1 gatttaacttattgataataaagttaaaaaacaaataaatacaagacaattggggccattttgactcatagaggaaagcatcgcgcacaaactttttcagtttatttgttggcttaatgttctatagttatctttatttgcagttttttatattgcatgaggtggtttttggagagaagaatgaggaagttgcgtcgagctacagaaacgttagctttacatatagcggaggtgatgtgaaattaatttacaagagaaataatttacatatcaaacagttagatgcttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z