BBa_K1078000 1 BBa_K1078000 Mxr1 (methanol expression regulator 1) modified 2013-09-11T11:00:00Z 2015-05-08T01:09:03Z The part was obtained by synthesis, the modified Mxr1p sequence was found in Parua PK, Ryan PM, Trang K, Young ET: Pichia pastoris 14-3-3 regulates transcriptional activity of the methanol inducible transcription factor Mxr1 by direct interaction. Mol Microbiol 2012, 85:282-298. Mxr1 (methanol expression regulator 1) is a key regulator, at transcriptional level, of methanol metabolism in the methylotrophic yeast Pichia pastoris. It is a transcriptional factor that binds upstream of the MUT (methanol utilizing) pathway and peroxisome biogenesis gene??s promoters using its zinc finger domain. Among the MUT genes is the AOX1 gene that is regulated by the pAOX1 promoter. Promoter found three times in the registry of parts; Part:BBa_K431007, Part:BBa_K945000, BBa_I764001, which is use for heterologous protein expression in Pichia. The 14-3-3 proteins are ubiquitous, and have important roles in controlling a wide variety of cellular processes, like gene expression, metabolism, cell cycle and apoptosis. These 14-3-3 proteins are involved in the carbon source-dependent regulation of Mxr1, which is inactive in ethanol and glycerol, but is active in methanol. Our submitted Mxr1 is mutated in order to be NOT repressed by methanol, as the original Mxr1 is. This is done by substituted the Ser215 of the protein with Ala, inactivating the 14-3-3 protein interaction (phosphorylation) with Mxr1. It is also smaller than the original Mxr1 because it was already reported that the the major activation domain of Mxr1 is located into the first 400 amino acids. The modified Mxr1 is able to activate the pAOX promoter, in ethanol, glycerol and methanol. This is useful for our biosensor design, which aims to detect levels of methanol above 2% in common alcoholic drinks (normal content of 10 to 60% ethanol). This will allow government to make high-throughput screening of ethanol drinks tainted will methanol. false false _1387_ 0 11298 9 In stock true After synthesis, in order to build our sensor the part was introduced in pPIC9K plasmid to allow its genomic recombination into the Pichia pastoris genome, substituting the original Mxr1 found in the yeast. false Edgar Andres Ochoa Cruz annotation2339073 1 cds range2339073 1 1 1203 BBa_K1078000_sequence 1 atgagcaatctacccccaacttttggttccactagacaatctccagaagaccaatcacctcccgtgcccaaggagctgtcattcaatgggaccacaccctcaggaaagctacgcttatttgtctgtcagacatgtactcgagcatttgctcgtcaggaacacttgaaacgacacgaaaggtctcacaccaaggagaaacctttcagctgcggcatttgttctcgtaaattcagccgtcgagatctgttattgagacatgcccaaaaactgcacagcaactgctctgatgcggccataacaagactaaggcgcaaggcaactcgtcggtcttctaatgccgcgggttccatatctggttctactccggtgacaacgccaaatactatgggtacgcccgaagatggcgagaaacgaaaagttcagaaactggccggccgccgggactcaaatgaacagaaactgcaactgcaacaacaacatctacagcaacaaccacagttgcaataccaacaatctcttaagcagcatgaaaatcaagtccagcagcctgatcaagatccattgatatccccgagaatgcaattattcaatgattccaaccatcacgtaaacaatttgtttgatcttggactaagaagagctgctttctccgccgttagtggaaataattatgcccattatgtgaataattttcaacaagatgcctcttctaccaatccaaatcaagattcaaataatgccgaatttgagaatattgaattttctaccccacaaatgatgcccgttgaagatgctgaaacttggatgaacaacatgggtccaattccgaacttctctctcgatgtgaacaggaacattggtgatagctttacagatatacaacacaagaactcagagcctattatatccgaaccgcccaaggacaccgctccaaacgacaagaagttgaatggctactctttttacgaagcccccatcaagccattagaatccctattttctgtcaggaatacaaagagaaacaagtataaaacaaatgacgactctccagacaccgtggataataactccgcaccggctgctaataccattcaagaacttgagtcttctttgaatgcatccaagaatttttgcttgccaactggttattccttctatggtaatttggaccaacagactttctctaacacgttatcatgctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z