BBa_K1078001 1 BBa_K1078001 Strong reporter device optimized for Pichia pastoris, activated by methanol 2013-09-11T11:00:00Z 2015-05-08T01:09:03Z he part was obtained by synthesis, the modified Mxr1p sequence was found in Hartner FS, Ruth C, Langenegger D, Johnson SN, Hyka P, Lin-Cereghino GP, Lin-Cereghino J, Kovar K, Cregg JM, Glieder A: Promoter library designed for fine-tuned gene expression in Pichia pastoris. Nucleic Acids Res 2008, 36:e76 This device is composed by three parts. The first part is a modified promoter pAOX, it was found in a library where it showed more than 60% stronger activation when compared with the wild-type, as reported by Hartner FS, Ruth C, Langenegger D, Johnson SN, Hyka P, Lin-Cereghino GP, Lin-Cereghino J, Kovar K, Cregg JM, Glieder A: Promoter library designed for fine-tuned gene expression in Pichia pastoris. Nucleic Acids Res 2008, 36:e76. The second part is the kozak sequence for Pichia pastoris, and the third is a Red fluorescent protein condon optimized for expression in Pichia pastoris. This device was created to express a reporter gene in the presence of ethanol, and is inactivated by ethanol, when combined with the modified Mxr1 (BBa_K1078000), it is not inactivated by ethanol. This is useful for our biosensor design, which aims to detect levels of methanol above 2% in common alcoholic drinks (normal content of 10 to 60% ethanol). This will allow government to make high-throughput screening of ethanol drinks tainted will methanol. The modified Mxr1 is able to activate the pAOX promoter, in ethanol, glycerol and methanol. This is useful for our biosensor design, which aims to detect levels of methanol above 2% in common alcoholic drinks (normal content of 10 to 60% ethanol). This will allow government to make high-throughput screening of ethanol drinks tainted will methanol. false false _1387_ 0 11298 9 In stock true After synthesis, in order to build our sensor the part was introduced in pPIC9K plasmid to allow its genomic recombination into the Pichia pastoris genome, substituting the original Mxr1 found in the yeast. This part does not have a single biobrick version with the Mx1p because both must be inserted in different genome locations at the Pichia pastoris false Edgar Andres Ochoa Cruz annotation2339065 1 pAOX modified range2339065 1 1 887 annotation2339071 1 Kozak sequence range2339071 1 888 899 annotation2339072 1 RFP modified range2339072 1 900 1577 BBa_K1078001_sequence 1 agatctaacatccaaagacgaaaggttgaatgaaacctttttgccatccgacatccacaggtccattctcacacataagtgccaaacgcaacaggaggggatacactagcagcagaccgttgcaaacgcaggacctccactcctcttctcctcaacacccacttaggctactaacaccatgactttattagcctgtctatcctggcccccctggcgaggttcatgtttgtttatttccgaatgcaacaagctccgcattacacccgaacatcactccagatgagggctttctgagtgtggggtcaaatagtttcatgttccccaaatggcccaaaactgacagtttaaacgctgtcttggaacctaatatgacaaaagcgtgatctcatccaagatgaactaagtttggttcgttgaaatgctaacggccagttggtcaaaaagaaacttccaaaagtcggcataccgtttgtcttgtttggtattgattgacgaatgctcaaaaataatctcattaatgcttagcgcagtctctctatcgcttctgaaccccggtgcacctgtgccgaaacgcaaatggggaaacacccgctttttggatgattatgcattgtctccacattgtatgcttccaagattctggtgggaatactgctgatagcctaacgttcatgatcaaaatttcatgatcaaaatttaactgttctaacccctacttgacagcaatatataaacagaaggaagctgccctgtcttaaacctttttttttatcatcattattagcttactttcataattgcgactggttccaattgacaagcttttgattttaacgacttttaacgacaacttgagaagatcaaaaaacaactaattattcgaaacgcccgccgccaccatggcttcctccgaggacgttatcaaagagttcatgagattcaaggttagaatggaaggttctgttaacggtcacgagttcgagattgaaggtgaaggtgagggtagaccatacgagggtactcaaactgctaagttgaaggttactaagggtggtccattgccattcgcttgggacattttgtccccacaattccagtacggttccaaggcttacgttaagcacccagctgatatcccagactacttgaagttgtctttcccagagggtttcaagtgggagagagttatgaacttcgaggacggtggtgttgttactgttactcaggactcctcattgcaggacggtgagttcatctacaaggttaagttgagaggaactaacttcccatccgacggtccagttatgcagaaaaagactatgggttgggaggcttccactgagagaatgtaccctgaagatggtgctttgaagggtgagatcaagatgagattgaaattgaaggatggtggtcactacgacgctgaggttaagactacttacatggctaagaagccagttcagttgccaggtgcttacaagactgacatcaagttggacatcacttcccacaacgaggactacactatcgttgagcaatacgagagagctgaaggtagacactccactggtgcttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z