BBa_K864400 1 BBa_K864400 Ptac, trp & lac regulated promoter 2012-09-24T11:00:00Z 2015-05-08T01:13:37Z Created from oligos ordered from SigmaAldrich. Oligo sequences: Ptac+ AATTCGCGGCCGCTTCTAGAGGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTA Ptac- CTAGTAAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGATGATTAATTGTCAACAGCTCCTCTAGAAGCGGCCGCG Released HQ 2013 The Ptac promoter is a functional hybrid promoter, derived from the trp and lac promoters, that are regulated by trp and lac [1]. This part also exist together with lacI, part [[Part:BBa_K180000|BBa_K180000]] [1] Proc. Natl. Acad. Sci. USA, Vol. 80, pp. 21-25 false false _1124_ 0 9827 9 In stock false Oligos ordered from SigmaAldrich were annealed to form a double stranded DNA segment, ready to be ligated into any BioBrick backbone. false Erik Lundin annotation2197240 1 lacO1 site range2197240 1 36 61 annotation2197238 1 -10 range2197238 1 29 33 annotation2197237 1 -35 range2197237 1 7 12 annotation2197236 1 Ptac range2197236 1 1 40 BBa_K1080006 1 "Plasto" Plastocyanin 2013-09-11T11:00:00Z 2016-10-20T07:04:30Z From genome of Chlamydomonas reinhardtii Copper binding protein false false _1389_ 7708 18463 9 In stock true Incorporated sequence overlap for Gibson assembly and no GC rich regions or restriction sites within sequence false Macquarie University annotation2525680 1 Plasto range2525680 1 25 321 annotation2525679 1 RBS range2525679 1 6 16 BBa_K1080014 1 Plasto+ Plasto (+ Ptac promoter) 2013-09-23T11:00:00Z 2015-05-08T01:09:03Z See BBa_K1080006 and BBa_K864400 This composite uses a Ptac promoter combined with our gene for plastocyanin. false false _1389_ 0 18612 9 Not in stock false See BBa_K1080006 and BBa_K864400 false Macquarie University component2364377 1 BBa_K864400 component2364378 1 BBa_K1080006 annotation2364377 1 BBa_K864400 range2364377 1 1 61 annotation2364378 1 BBa_K1080006 range2364378 1 70 393 BBa_K1080014_sequence 1 gagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttactagagagctttaagaaggagatatacataatggctaccgtcaagctgggtgctgactctggtgctctggagttcgtccctaagaccctgaccatcaagtccggcgagaccgtgaacttcgtgaacaacgctggcttcccacacaacatcgtcttcgacgaggatgccatcccatccggtgtgaacgctgatgccatctcccgcgatgactacctgaacgcacctggtgagacctactcggtgaagctgaccgctgctggtgagtacggctactactgcgaacctcaccagggtgctggcatggtcggcaagatcattgtccagtaataa BBa_K1080006_sequence 1 agctttaagaaggagatatacataatggctaccgtcaagctgggtgctgactctggtgctctggagttcgtccctaagaccctgaccatcaagtccggcgagaccgtgaacttcgtgaacaacgctggcttcccacacaacatcgtcttcgacgaggatgccatcccatccggtgtgaacgctgatgccatctcccgcgatgactacctgaacgcacctggtgagacctactcggtgaagctgaccgctgctggtgagtacggctactactgcgaacctcaccagggtgctggcatggtcggcaagatcattgtccagtaataa BBa_K864400_sequence 1 gagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z