BBa_K1081001 1 BBa_K1081001 rpoZ->omega 2013-09-01T11:00:00Z 2015-05-08T01:09:04Z The gene coding omega is rpoZ,comes from E.coli K12. Omega is a subunit of RNA polymearse in E.coli. In our project, we fuse omega with dead cas9(dcas9),in which two mutations were introduced to abolish the endonuclease function, to be a core part of the trancriptional activation module. false false _1390_ 0 16101 9 In stock false Add prefix or suffix to both end of the rpoZ coding region. false Hangxing Jia annotation2334381 1 ropZ->Omega range2334381 1 1 276 BBa_K1081001_sequence 1 atggcacgcgtaactgttcaggacgctgtagagaaaattggtaaccgttttgacctggtactggtcgccgcgcgtcgcgctcgtcagatgcaggtaggcggaaaggatccgctggtaccggaagaaaacgataaaaccactgtaatcgcgctgcgcgaaatcgaagaaggtctgatcaacaaccagatcctcgacgttcgcgaacgccaggaacagcaagagcaggaagccgctgaattacaagccgttaccgctattgctgaaggtcgtcgttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z