BBa_K1085000 1 BBa_K1085000 RBS Start-codon Strep-tag SpiderSilkSubunitE1 2013-08-29T11:00:00Z 2016-02-10T01:07:41Z The amino acids sequence of the silk protein was obtained from the paper by Brooks et al. (2008). The DNA sequence was synthesized by Integrated DNA Technologies (IDT). The part contains the coding sequence for part of the spider silk protein together with Bacillus Subtilis ribosome binding site (RBS) and the Strep-tag. false false _1395_ 4206 16111 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2333670 1 Strep range2333670 1 17 40 annotation2333671 1 spidersilk subunit E1 range2333671 1 59 268 annotation2338313 1 starting codon (ATG) range2338313 1 14 16 annotation2333669 1 RBS range2333669 1 1 6 BBa_K1085000_sequence 1 aggaggcatatccatgtggagccatccgcagtttgaaaaatccgcagcagcatccgcaggcggatacggaccaggagcaggccaacaaggcccaggctcacaaggcccaggctcaggcggacaacaaggaccaggcggacaaggcggctacggaccaggcgccggacaacaaggcccaggcagccaaggaccaggcagcggcggccaacaaggcccaggaggacaaggaccatacggcccaagcgcagcagccgcagcagccgcagcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z