BBa_K1085001 1 BBa_K1085001 RBS Start-codon SpiderSilkSubunitE1 2013-09-09T11:00:00Z 2016-02-10T01:07:59Z The amino acids sequence of the silk protein was obtained from the paper by Brooks et al. (2008). The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitE1) with Bacillus Subtilis ribosome binding site (RBS) infront of it. The RBS is there to allow the ribosomes to bind and start to translate the DNA. SubunitE1 codes for a spider silk protein that is optimized to prevent the forming of secundary RNA structures in close proximity to the RBS. This is given priority over reducing the number of restriction sites. However, the primary goal of the algorithm was still to optimize the codon selection based on their availbility scores. false false _1395_ 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2338309 1 RBS range2338309 1 1 6 annotation2338312 1 spidersilk subunit E1 range2338312 1 17 226 annotation2338314 1 starting codon (ATG) range2338314 1 14 16 BBa_K1085001_sequence 1 aggaggcatatccatgggcggatacggaccaggagcaggccaacaaggcccaggctcacaaggcccaggctcaggcggacaacaaggaccaggcggacaaggcggctacggaccaggcgccggacaacaaggcccaggcagccaaggaccaggcagcggcggccaacaaggcccaggaggacaaggaccatacggcccaagcgcagcagccgcagcagccgcagcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z