BBa_K1085003 1 BBa_K1085003 SpiderSilkSubunitE2 Strep-tag 2013-09-09T11:00:00Z 2016-02-10T01:09:12Z The amino acids sequence of the silk protein was obtained from the paper by Brooks et al. (2008). The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitE2) and a Strep-tag behind it. SubunitE2 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to minimize the number of restriction sites, and the tetrary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS. The amino acid sequence is based on the adapted MaSp2 sequences discribed in the paper of Brooks et. al. 2008. The Strep-tag, fused at the C terminal, is used both as a binding tag to use to inidicate its production and as a binding component to biotin. false false _1395_ 0 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339045 1 strep range2339045 1 229 252 annotation2339046 1 spidersilk subunit E2 range2339046 1 1 210 BBa_K1085003_sequence 1 ggcggatacggcccaggcgcaggccaacaaggaccaggcagccaaggaccaggctcaggcggacaacaaggcccaggcggacaaggcggctacggcccaggcgccggacaacaaggaccaggctcacaaggaccaggctccggcggacaacaaggaccaggcggccaaggaccatacggaccaagcgcagcagccgcagcagccgccgcatccgcagcagcatccgcatggagccatccgcagtttgaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z