BBa_K1085004 1 BBa_K1085004 RBS Start-codon SpiderSilkSubunitN1 Strep-tag 2013-09-09T11:00:00Z 2015-06-02T12:19:48Z The amino acids sequence of the silk protein was obtained from the paper by Brooks et al. (2008). The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitN1) with a Bacillus Subtilis ribosome binding site (RBS) and the Strep-tag infront of it. The RBS is there to allow the ribosomes to bind and start to translate the DNA. The Strep-tag, fused at the N terminal, is used both as a binding tag to use to inidicate its production and as a binding component to biotin. SubunitN1 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS, and the tetrary goal was to minimize the number of restriction sites. false false _1395_ 0 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339051 1 spidersilk subunit N1 range2339051 1 59 199 annotation2339048 1 starting codon (ATG) range2339048 1 14 16 annotation2339047 1 RBS range2339047 1 1 6 annotation2339049 1 strep range2339049 1 17 40 BBa_K1085004_sequence 1 aggaggcatatccatgtggagccatccgcagtttgaaaaatccgcagcagcatccgcaccaggaggagccggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z