BBa_K1085005 1 BBa_K1085005 RBS Start-codon SpiderSilkSubunitN1 2013-09-09T11:00:00Z 2016-02-10T01:11:44Z The amino acids sequence of the silk protein was obtained from MaSp2. The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitN1) with Bacillus Subtilis ribosome binding site (RBS) infront of it. The RBS is there to allow the ribosomes to bind and start to translate the DNA. SubunitN1 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS, and the tetrary goal was to minimize the number of restriction sites. false false _1395_ 0 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339053 1 starting codon (ATG) range2339053 1 14 16 annotation2339054 1 spidersilk subunit N1 range2339054 1 17 157 annotation2339052 1 RBS range2339052 1 1 6 BBa_K1085005_sequence 1 aggaggcatatccatgccaggaggagccggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z