BBa_K1085009 1 BBa_K1085009 SilkTail Strep-tag Stop-codon 2013-09-09T11:00:00Z 2015-06-02T12:11:00Z The amino acid sequence of the tail was obtained from MaSp2. The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for silk tail with a Strep-tag behind it and ends with a stop codon. The Tail ??????. The Strep-tag, fused at the C terminal, is used both as a binding tag to use to inidicate its production and as a binding component to biotin. false false _1395_ 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339062 1 spidersilk C-terminal domain range2339062 1 1 270 annotation2339061 1 strep range2339061 1 289 312 annotation2362391 1 Stop codon (TGA) range2362391 1 313 315 BBa_K1085009_sequence 1 gccccagttgcctccgcagccgcctcaaggctgtcctcccctcaagcctcctcccgtgtttcatccgccgtgtccactctcgtgtcctccggacctacgaatcctgccgccttatccaatgccatctccagcgttgtatcacaagtttcagcctccaatcctggactatccggatgtgacgttctcgttcaagccctcctcgaactcgtatccgccctcgtacacatcctcggctcctcctccattggacaaattaattacgccgcctcctccgcagcagcatccgcatggagccatccgcagtttgaaaaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z