BBa_K1085010 1 BBa_K1085010 RBS Start-codon EstA Strep-tag SpiderSilkSubunitE1 2013-09-09T11:00:00Z 2016-02-10T01:09:30Z The amino acid sequence of the silk protein was obtained from the paper by Brooks et al. (2008). The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitE1) with a Bacillus Subtilis ribosome binding site (RBS), a coding sequence for the signal protein EstA and a Strep-tag infront of it. The RBS is there to allow the ribosomes to bind and start to translate the DNA. The EstA codes for a signal protein that that is there to fasilitate secretion of the protein. The Strep-tag, fused at the N terminal, is used both as a binding tag to use to inidicate its production and as a binding component to biotin. SubunitE1 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS, and the tetrary goal was to minimize the number of restriction sites. The amino acid sequence is based on the adapted MaSp2 sequences discribed in the paper of Brooks et. al. 2008. false false _1395_ 4206 16089 9 It's complicated false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339063 1 RBS range2339063 1 1 6 annotation2362247 1 starting codon (ATG) range2362247 1 14 16 annotation2339066 1 strep range2339066 1 656 679 annotation2339067 1 spidersilk subunit E1 range2339067 1 698 907 annotation2339064 1 estA (Bac. sub.) range2339064 1 17 649 BBa_K1085010_sequence 1 aggaggcatatccatgaaatttgtaaaaagaaggatcattgcacttgtaacaattttgatgctgtctgttacatcgctgtttgcgttgcagccgtcagcaaaagccgctgaacacaatccagtcgttatggttcacggtattggaggggcatcattcaattttgcgggaattaagagctatctcgtatctcagggctggtcgcgggacaagctgtatgcagttgatttttgggacaagacaggcacaaattataacaatggaccggtattatcacgatttgtgcaaaaggttttagatgaaacgggtgcgaaaaaagtggatattgtcgctcacagcatggggggcgcgaacacactttactacataaaaaatctggacggcggaaataaagttgcaaacgtcgtgacgcttggcggcgcgaaccgtttgacgacaggcaaggcgcttccgggaacagatccaaatcaaaagattttatacacatccatttacagcagtgccgatatgattgtcatgaattacttatcaagattagatggtgctagaaacgttcaaatccatggcgttggacacatcggccttctgtacagcagccaagtcaacagcctgattaaagaagggctgaacggcgggggccagaatacgaatggatcctggagccatccgcagtttgaaaaatccgcagcagcatccgcaggcggatacggaccaggagcaggccaacaaggcccaggctcacaaggcccaggctcaggcggacaacaaggaccaggcggacaaggcggctacggaccaggcgccggacaacaaggcccaggcagccaaggaccaggcagcggcggccaacaaggcccaggaggacaaggaccatacggcccaagcgcagcagccgcagcagccgcagcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z