BBa_K1085011 1 BBa_K1085011 RBS Start-codon EstA SpiderSilkSubunitE1 2013-09-09T11:00:00Z 2015-05-08T01:09:05Z The amino acids sequence of the silk protein was obtained from the paper by Brooks et al. (2008). The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitE1) with a Bacillus Subtilis ribosome binding site (RBS) and a coding sequence for the signal protein EstA infront of it. The RBS is there to allow the ribosomes to bind and start to translate the DNA. The EstA codes for a signal protein that that is there to fasilitate secretion of the protein. SubunitE1 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS, and the tetrary goal was to minimize the number of restriction sites. The amino acid sequence is based on the adapted MaSp2 sequences discribed in the paper of Brooks et. al. 2008. false false _1395_ 0 16089 9 Not in stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339068 1 RBS range2339068 1 1 6 annotation2362248 1 starting codon (ATG) range2362248 1 14 16 annotation2339070 1 spidersilk subunit E1 range2339070 1 656 865 annotation2339069 1 estA (Bac. sub.) range2339069 1 17 649 BBa_K1085011_sequence 1 aggaggcatatccatgaaatttgtaaaaagaaggatcattgcacttgtaacaattttgatgctgtctgttacatcgctgtttgcgttgcagccgtcagcaaaagccgctgaacacaatccagtcgttatggttcacggtattggaggggcatcattcaattttgcgggaattaagagctatctcgtatctcagggctggtcgcgggacaagctgtatgcagttgatttttgggacaagacaggcacaaattataacaatggaccggtattatcacgatttgtgcaaaaggttttagatgaaacgggtgcgaaaaaagtggatattgtcgctcacagcatggggggcgcgaacacactttactacataaaaaatctggacggcggaaataaagttgcaaacgtcgtgacgcttggcggcgcgaaccgtttgacgacaggcaaggcgcttccgggaacagatccaaatcaaaagattttatacacatccatttacagcagtgccgatatgattgtcatgaattacttatcaagattagatggtgctagaaacgttcaaatccatggcgttggacacatcggccttctgtacagcagccaagtcaacagcctgattaaagaagggctgaacggcgggggccagaatacgaatggatccggcggatacggaccaggagcaggccaacaaggcccaggctcacaaggcccaggctcaggcggacaacaaggaccaggcggacaaggcggctacggaccaggcgccggacaacaaggcccaggcagccaaggaccaggcagcggcggccaacaaggcccaggaggacaaggaccatacggcccaagcgcagcagccgcagcagccgcagcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z