BBa_K1085002 1 BBa_K1085002 SpiderSilkSubunitE2 2013-09-09T11:00:00Z 2016-02-10T01:08:23Z The amino acids sequence of the silk protein was obtained from the paper by Brooks et al. (2008). The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitE1) with Bacillus Subtilis ribosome binding site (RBS) infront of it. The RBS is there to allow the ribosomes to bind and start to translate the DNA. SubunitE1 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS, and the tetrary goal was to minimize the number of restriction sites. The amino acid sequence is based on the adapted MaSp2 sequences discribed in the paper of Brooks et. al. 2008. false false _1395_ 0 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339043 1 spidersilk subunit E2 range2339043 1 1 210 BBa_K1085015 1 BBa_K1085015 RBS Start-codon Strep-tag SpiderSilkSubunitE1 SpiderSilkSubunitE2 2013-09-09T11:00:00Z 2016-02-10T11:31:42Z The amino acids sequence of the silk protein was obtained from the paper by Brooks et al. (2008). The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for two parts of the spider silk proteins (SubunitE1 and SubunitE2) with a Bacillus Subtilis ribosome binding site (RBS) and a Strep-tag infront of it. The RBS is there to allow the ribosomes to bind and start to translate the DNA. The Strep-tag, fused at the N terminal, is used both as a binding tag to use to inidicate its production and as a binding component to biotin. SubunitE1 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS, and the tetrary goal was to minimize the number of restriction sites. SubunitE2 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to minimize the number of restriction sites, and the tetrary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS. false false _1395_ 4206 16089 9 Not in stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher component2361170 1 BBa_K1085000 component2361172 1 BBa_K1085002 annotation2361172 1 BBa_K1085002 range2361172 1 277 486 annotation2361170 1 BBa_K1085000 range2361170 1 1 268 BBa_K1085000 1 BBa_K1085000 RBS Start-codon Strep-tag SpiderSilkSubunitE1 2013-08-29T11:00:00Z 2016-02-10T01:07:41Z The amino acids sequence of the silk protein was obtained from the paper by Brooks et al. (2008). The DNA sequence was synthesized by Integrated DNA Technologies (IDT). The part contains the coding sequence for part of the spider silk protein together with Bacillus Subtilis ribosome binding site (RBS) and the Strep-tag. false false _1395_ 4206 16111 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2338313 1 starting codon (ATG) range2338313 1 14 16 annotation2333669 1 RBS range2333669 1 1 6 annotation2333671 1 spidersilk subunit E1 range2333671 1 59 268 annotation2333670 1 Strep range2333670 1 17 40 BBa_K1085015_sequence 1 aggaggcatatccatgtggagccatccgcagtttgaaaaatccgcagcagcatccgcaggcggatacggaccaggagcaggccaacaaggcccaggctcacaaggcccaggctcaggcggacaacaaggaccaggcggacaaggcggctacggaccaggcgccggacaacaaggcccaggcagccaaggaccaggcagcggcggccaacaaggcccaggaggacaaggaccatacggcccaagcgcagcagccgcagcagccgcagcctactagagggcggatacggcccaggcgcaggccaacaaggaccaggcagccaaggaccaggctcaggcggacaacaaggcccaggcggacaaggcggctacggcccaggcgccggacaacaaggaccaggctcacaaggaccaggctccggcggacaacaaggaccaggcggccaaggaccatacggaccaagcgcagcagccgcagcagccgccgca BBa_K1085002_sequence 1 ggcggatacggcccaggcgcaggccaacaaggaccaggcagccaaggaccaggctcaggcggacaacaaggcccaggcggacaaggcggctacggcccaggcgccggacaacaaggaccaggctcacaaggaccaggctccggcggacaacaaggaccaggcggccaaggaccatacggaccaagcgcagcagccgcagcagccgccgca BBa_K1085000_sequence 1 aggaggcatatccatgtggagccatccgcagtttgaaaaatccgcagcagcatccgcaggcggatacggaccaggagcaggccaacaaggcccaggctcacaaggcccaggctcaggcggacaacaaggaccaggcggacaaggcggctacggaccaggcgccggacaacaaggcccaggcagccaaggaccaggcagcggcggccaacaaggcccaggaggacaaggaccatacggcccaagcgcagcagccgcagcagccgcagcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z