BBa_K1085016 1 BBa_K1085016 RBS Start-codon SpiderSilkSubunitE1 SpiderSilkSubunitE2 2013-09-09T11:00:00Z 2015-06-02T12:16:32Z The amino acids sequence of the silk protein was obtained from the paper by Brooks et al. (2008). The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for two parts of the spider silk proteins (SubunitE1 and SubunitE2) with a Bacillus Subtilis ribosome binding site (RBS) infront of it. The RBS is there to allow the ribosomes to bind and start to translate the DNA. SubunitE1 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS, and the tetrary goal was to minimize the number of restriction sites. SubunitE2 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to minimize the number of restriction sites, and the tetrary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS. false false _1395_ 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher BBa_K1085016_sequence 1 aggaggcatatccatgggcggatacggaccaggagcaggccaacaaggcccaggctcacaaggcccaggctcaggcggacaacaaggaccaggcggacaaggcggctacggaccaggcgccggacaacaaggcccaggcagccaaggaccaggcagcggcggccaacaaggcccaggaggacaaggaccatacggcccaagcgcagcagccgcagcagccgcagccactagaggcggatacggcccaggcgcaggccaacaaggaccaggcagccaaggaccaggctcaggcggacaacaaggcccaggcggacaaggcggctacggcccaggcgccggacaacaaggaccaggctcacaaggaccaggctccggcggacaacaaggaccaggcggccaaggaccatacggaccaagcgcagcagccgcagcagccgccgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z