BBa_K1085006 1 BBa_K1085006 SpiderSilkSubunitN2 2013-09-09T11:00:00Z 2016-02-10T01:07:20Z The amino acids sequence of the silk protein was obtained from MaSp2. The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitN2). SubunitN2 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to minimize the number of restriction sites, and the tetrary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS. false false _1395_ 0 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339055 1 spidersilk subunit N2 range2339055 1 1 129 BBa_K1085020 1 BBa_K1085020 RBS Start-codon EstA SpiderSilkSubunitN1 SpiderSilkSubunitN2 SilkTail Strep-tag Stop-codon 2013-09-15T11:00:00Z 2015-05-08T01:09:05Z blabla blabla false false _1395_ 0 16111 9 It's complicated false blabla false Claudio Tiecher component2346735 1 BBa_K1085006 component2346733 1 BBa_K1085012 component2346738 1 BBa_K1085009 annotation2346733 1 BBa_K1085012 range2346733 1 1 838 annotation2346738 1 BBa_K1085009 range2346738 1 984 1298 annotation2346735 1 BBa_K1085006 range2346735 1 847 975 BBa_K1085012 1 BBa_K1085012 RBS Start-codon EstA Strep-tag SpiderSilkSubunitN1 2013-09-09T11:00:00Z 2016-02-10T01:09:46Z The amino acids sequence of the silk protein was obtained from MaSp2. The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitN1) with a Bacillus Subtilis ribosome binding site (RBS), a coding sequence for the signal protein EstA and a Strep-tag infront of it. The RBS is there to allow the ribosomes to bind and start to translate the DNA. The EstA codes for a signal protein that that is there to fasilitate secretion of the protein. The Strep-tag, fused at the N terminal, is used both as a binding tag to use to inidicate its production and as a binding component to biotin. SubunitN1 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS, and the tetrary goal was to minimize the number of restriction sites. false false _1395_ 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2362251 1 estA (Bac. sub.) range2362251 1 17 649 annotation2362252 1 strep range2362252 1 656 679 annotation2362253 1 spidersilk subunit N1 range2362253 1 698 838 annotation2362249 1 RBS range2362249 1 1 6 annotation2362250 1 starting codon (ATG) range2362250 1 14 16 BBa_K1085009 1 BBa_K1085009 SilkTail Strep-tag Stop-codon 2013-09-09T11:00:00Z 2015-06-02T12:11:00Z The amino acid sequence of the tail was obtained from MaSp2. The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for silk tail with a Strep-tag behind it and ends with a stop codon. The Tail ??????. The Strep-tag, fused at the C terminal, is used both as a binding tag to use to inidicate its production and as a binding component to biotin. false false _1395_ 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339061 1 strep range2339061 1 289 312 annotation2362391 1 Stop codon (TGA) range2362391 1 313 315 annotation2339062 1 spidersilk C-terminal domain range2339062 1 1 270 BBa_K1085020_sequence 1 aggaggcatatccatgaaatttgtaaaaagaaggatcattgcacttgtaacaattttgatgctgtctgttacatcgctgtttgcgttgcagccgtcagcaaaagccgctgaacacaatccagtcgttatggttcacggtattggaggggcatcattcaattttgcgggaattaagagctatctcgtatctcagggctggtcgcgggacaagctgtatgcagttgatttttgggacaagacaggcacaaattataacaatggaccggtattatcacgatttgtgcaaaaggttttagatgaaacgggtgcgaaaaaagtggatattgtcgctcacagcatggggggcgcgaacacactttactacataaaaaatctggacggcggaaataaagttgcaaacgtcgtgacgcttggcggcgcgaaccgtttgacgacaggcaaggcgcttccgggaacagatccaaatcaaaagattttatacacatccatttacagcagtgccgatatgattgtcatgaattacttatcaagattagatggtgctagaaacgttcaaatccatggcgttggacacatcggccttctgtacagcagccaagtcaacagcctgattaaagaagggctgaacggcgggggccagaatacgaatggatcctggagccatccgcagtttgaaaaatccgcagcagcatccgcaccaggaggagccggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagcatactagagggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagcatactagaggccccagttgcctccgcagccgcctcaaggctgtcctcccctcaagcctcctcccgtgtttcatccgccgtgtccactctcgtgtcctccggacctacgaatcctgccgccttatccaatgccatctccagcgttgtatcacaagtttcagcctccaatcctggactatccggatgtgacgttctcgttcaagccctcctcgaactcgtatccgccctcgtacacatcctcggctcctcctccattggacaaattaattacgccgcctcctccgcagcagcatccgcatggagccatccgcagtttgaaaaatga BBa_K1085006_sequence 1 ggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagca BBa_K1085012_sequence 1 aggaggcatatccatgaaatttgtaaaaagaaggatcattgcacttgtaacaattttgatgctgtctgttacatcgctgtttgcgttgcagccgtcagcaaaagccgctgaacacaatccagtcgttatggttcacggtattggaggggcatcattcaattttgcgggaattaagagctatctcgtatctcagggctggtcgcgggacaagctgtatgcagttgatttttgggacaagacaggcacaaattataacaatggaccggtattatcacgatttgtgcaaaaggttttagatgaaacgggtgcgaaaaaagtggatattgtcgctcacagcatggggggcgcgaacacactttactacataaaaaatctggacggcggaaataaagttgcaaacgtcgtgacgcttggcggcgcgaaccgtttgacgacaggcaaggcgcttccgggaacagatccaaatcaaaagattttatacacatccatttacagcagtgccgatatgattgtcatgaattacttatcaagattagatggtgctagaaacgttcaaatccatggcgttggacacatcggccttctgtacagcagccaagtcaacagcctgattaaagaagggctgaacggcgggggccagaatacgaatggatcctggagccatccgcagtttgaaaaatccgcagcagcatccgcaccaggaggagccggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagca BBa_K1085009_sequence 1 gccccagttgcctccgcagccgcctcaaggctgtcctcccctcaagcctcctcccgtgtttcatccgccgtgtccactctcgtgtcctccggacctacgaatcctgccgccttatccaatgccatctccagcgttgtatcacaagtttcagcctccaatcctggactatccggatgtgacgttctcgttcaagccctcctcgaactcgtatccgccctcgtacacatcctcggctcctcctccattggacaaattaattacgccgcctcctccgcagcagcatccgcatggagccatccgcagtttgaaaaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z