BBa_K1085006 1 BBa_K1085006 SpiderSilkSubunitN2 2013-09-09T11:00:00Z 2016-02-10T01:07:20Z The amino acids sequence of the silk protein was obtained from MaSp2. The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitN2). SubunitN2 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to minimize the number of restriction sites, and the tetrary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS. false false _1395_ 0 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339055 1 spidersilk subunit N2 range2339055 1 1 129 BBa_K1085024 1 BBa_K1085024 RBS Start-codon EstA Strep-tag SpiderSilkSubunitN1 SpiderSilkSubunitN2 2013-09-15T11:00:00Z 2016-02-10T11:31:03Z blabla blabla false false _1395_ 4206 16111 9 It's complicated false blabla false Claudio Tiecher component2347026 1 BBa_K1085006 component2347024 1 BBa_K1085012 annotation2347024 1 BBa_K1085012 range2347024 1 1 838 annotation2347026 1 BBa_K1085006 range2347026 1 847 975 BBa_K1085012 1 BBa_K1085012 RBS Start-codon EstA Strep-tag SpiderSilkSubunitN1 2013-09-09T11:00:00Z 2016-02-10T01:09:46Z The amino acids sequence of the silk protein was obtained from MaSp2. The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitN1) with a Bacillus Subtilis ribosome binding site (RBS), a coding sequence for the signal protein EstA and a Strep-tag infront of it. The RBS is there to allow the ribosomes to bind and start to translate the DNA. The EstA codes for a signal protein that that is there to fasilitate secretion of the protein. The Strep-tag, fused at the N terminal, is used both as a binding tag to use to inidicate its production and as a binding component to biotin. SubunitN1 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS, and the tetrary goal was to minimize the number of restriction sites. false false _1395_ 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2362253 1 spidersilk subunit N1 range2362253 1 698 838 annotation2362251 1 estA (Bac. sub.) range2362251 1 17 649 annotation2362250 1 starting codon (ATG) range2362250 1 14 16 annotation2362249 1 RBS range2362249 1 1 6 annotation2362252 1 strep range2362252 1 656 679 BBa_K1085006_sequence 1 ggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagca BBa_K1085024_sequence 1 aggaggcatatccatgaaatttgtaaaaagaaggatcattgcacttgtaacaattttgatgctgtctgttacatcgctgtttgcgttgcagccgtcagcaaaagccgctgaacacaatccagtcgttatggttcacggtattggaggggcatcattcaattttgcgggaattaagagctatctcgtatctcagggctggtcgcgggacaagctgtatgcagttgatttttgggacaagacaggcacaaattataacaatggaccggtattatcacgatttgtgcaaaaggttttagatgaaacgggtgcgaaaaaagtggatattgtcgctcacagcatggggggcgcgaacacactttactacataaaaaatctggacggcggaaataaagttgcaaacgtcgtgacgcttggcggcgcgaaccgtttgacgacaggcaaggcgcttccgggaacagatccaaatcaaaagattttatacacatccatttacagcagtgccgatatgattgtcatgaattacttatcaagattagatggtgctagaaacgttcaaatccatggcgttggacacatcggccttctgtacagcagccaagtcaacagcctgattaaagaagggctgaacggcgggggccagaatacgaatggatcctggagccatccgcagtttgaaaaatccgcagcagcatccgcaccaggaggagccggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagcatactagagggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagca BBa_K1085012_sequence 1 aggaggcatatccatgaaatttgtaaaaagaaggatcattgcacttgtaacaattttgatgctgtctgttacatcgctgtttgcgttgcagccgtcagcaaaagccgctgaacacaatccagtcgttatggttcacggtattggaggggcatcattcaattttgcgggaattaagagctatctcgtatctcagggctggtcgcgggacaagctgtatgcagttgatttttgggacaagacaggcacaaattataacaatggaccggtattatcacgatttgtgcaaaaggttttagatgaaacgggtgcgaaaaaagtggatattgtcgctcacagcatggggggcgcgaacacactttactacataaaaaatctggacggcggaaataaagttgcaaacgtcgtgacgcttggcggcgcgaaccgtttgacgacaggcaaggcgcttccgggaacagatccaaatcaaaagattttatacacatccatttacagcagtgccgatatgattgtcatgaattacttatcaagattagatggtgctagaaacgttcaaatccatggcgttggacacatcggccttctgtacagcagccaagtcaacagcctgattaaagaagggctgaacggcgggggccagaatacgaatggatcctggagccatccgcagtttgaaaaatccgcagcagcatccgcaccaggaggagccggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z