BBa_K1085001 1 BBa_K1085001 RBS Start-codon SpiderSilkSubunitE1 2013-09-09T11:00:00Z 2016-02-10T01:07:59Z The amino acids sequence of the silk protein was obtained from the paper by Brooks et al. (2008). The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitE1) with Bacillus Subtilis ribosome binding site (RBS) infront of it. The RBS is there to allow the ribosomes to bind and start to translate the DNA. SubunitE1 codes for a spider silk protein that is optimized to prevent the forming of secundary RNA structures in close proximity to the RBS. This is given priority over reducing the number of restriction sites. However, the primary goal of the algorithm was still to optimize the codon selection based on their availbility scores. false false _1395_ 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2338314 1 starting codon (ATG) range2338314 1 14 16 annotation2338309 1 RBS range2338309 1 1 6 annotation2338312 1 spidersilk subunit E1 range2338312 1 17 226 BBa_K1085026 1 BBa_K1085026 RBS Start-codon SpiderSilkSubunitE1 SpiderSilkSubunitE2 x2 2013-09-15T11:00:00Z 2015-05-08T01:09:05Z blabla blabla false false _1395_ 0 16111 9 It's complicated false blabla false Claudio Tiecher component2347030 1 BBa_K1085001 component2347032 1 BBa_K1085002 component2347034 1 BBa_K1085002 annotation2347034 1 BBa_K1085002 range2347034 1 453 662 annotation2347030 1 BBa_K1085001 range2347030 1 1 226 annotation2347032 1 BBa_K1085002 range2347032 1 235 444 BBa_K1085002 1 BBa_K1085002 SpiderSilkSubunitE2 2013-09-09T11:00:00Z 2016-02-10T01:08:23Z The amino acids sequence of the silk protein was obtained from the paper by Brooks et al. (2008). The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitE1) with Bacillus Subtilis ribosome binding site (RBS) infront of it. The RBS is there to allow the ribosomes to bind and start to translate the DNA. SubunitE1 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS, and the tetrary goal was to minimize the number of restriction sites. The amino acid sequence is based on the adapted MaSp2 sequences discribed in the paper of Brooks et. al. 2008. false false _1395_ 0 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339043 1 spidersilk subunit E2 range2339043 1 1 210 BBa_K1085002_sequence 1 ggcggatacggcccaggcgcaggccaacaaggaccaggcagccaaggaccaggctcaggcggacaacaaggcccaggcggacaaggcggctacggcccaggcgccggacaacaaggaccaggctcacaaggaccaggctccggcggacaacaaggaccaggcggccaaggaccatacggaccaagcgcagcagccgcagcagccgccgca BBa_K1085026_sequence 1 aggaggcatatccatgggcggatacggaccaggagcaggccaacaaggcccaggctcacaaggcccaggctcaggcggacaacaaggaccaggcggacaaggcggctacggaccaggcgccggacaacaaggcccaggcagccaaggaccaggcagcggcggccaacaaggcccaggaggacaaggaccatacggcccaagcgcagcagccgcagcagccgcagcctactagagggcggatacggcccaggcgcaggccaacaaggaccaggcagccaaggaccaggctcaggcggacaacaaggcccaggcggacaaggcggctacggcccaggcgccggacaacaaggaccaggctcacaaggaccaggctccggcggacaacaaggaccaggcggccaaggaccatacggaccaagcgcagcagccgcagcagccgccgcatactagagggcggatacggcccaggcgcaggccaacaaggaccaggcagccaaggaccaggctcaggcggacaacaaggcccaggcggacaaggcggctacggcccaggcgccggacaacaaggaccaggctcacaaggaccaggctccggcggacaacaaggaccaggcggccaaggaccatacggaccaagcgcagcagccgcagcagccgccgca BBa_K1085001_sequence 1 aggaggcatatccatgggcggatacggaccaggagcaggccaacaaggcccaggctcacaaggcccaggctcaggcggacaacaaggaccaggcggacaaggcggctacggaccaggcgccggacaacaaggcccaggcagccaaggaccaggcagcggcggccaacaaggcccaggaggacaaggaccatacggcccaagcgcagcagccgcagcagccgcagcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z