BBa_K1085035 1 BBa_K1085035 EstA Strep-tag SpiderSilkSubunitE1 2013-10-03T11:00:00Z 2015-05-08T01:09:05Z The amino acids sequence of the silk protein was obtained from the paper by Brooks et al. (2008) and are from the MaSp2 of the <i>Argiope aurantia</i>. The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This biobrick contains signal sequence EstA attached to the silk subunit E1 with an N-terminal strep-tag. The Strep-tag, fused at the N-terminal, is used both as a binding tag to use to indicate its production and as a binding component to Streptavidin. Subunit E1 codes for a spider silk protein that is optimized for maximal expression in <i>Bacillus subtilis</i> 168. The primary goal of the algorithm was to optimize the codon selection based on their availability scores. The secondary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS, and the tertiary goal was to minimize the number of restriction sites. The amino acid sequence is based on the adapted MaSp2 sequences described in the paper of Brooks et. al. 2008. false false _1395_ 0 16111 9 Not in stock false The DNA sequence of subunit E1 was codon-optimized for Bacillus subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Mirjam Groenewold annotation2367752 1 spider silk subunit E1 range2367752 1 156 365 annotation2367748 1 RBS range2367748 1 1 6 annotation2367751 1 strep range2367751 1 114 137 annotation2367750 1 estA-SRP range2367750 1 18 107 annotation2367749 1 starting codon (ATG) range2367749 1 15 17 BBa_K1085035_sequence 1 aggaggaggatattatgaaatttgtaaaaagaaggatcattgcacttgtaacaattttgatgctgtctgttacatcgctgtttgcgttgcagccgtcagcaaaagccggatcctggagccatccgcagtttgaaaaatccgcagcagcatccgcaggcggatacggaccaggagcaggccaacaaggcccaggctcacaaggcccaggctcaggcggacaacaaggaccaggcggacaaggcggctacggaccaggcgccggacaacaaggcccaggcagccaaggaccaggcagcggcggccaacaaggcccaggaggacaaggaccatacggcccaagcgcagcagccgcagcagccgcagcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z