BBa_K1085033 1 BBa_K1085033 MotB Strep-tag SilkSubunitE1 2013-09-16T11:00:00Z 2015-05-08T01:09:05Z Bla Bla false false _1395_ 0 16089 9 It's complicated false Bla false Mirjam Groenewold annotation2367923 1 dna range2367923 1 127 150 annotation2367915 1 SS-MotB range2367915 1 1 120 annotation2367921 1 E1 range2367921 1 169 378 BBa_K1085002 1 BBa_K1085002 SpiderSilkSubunitE2 2013-09-09T11:00:00Z 2016-02-10T01:08:23Z The amino acids sequence of the silk protein was obtained from the paper by Brooks et al. (2008). The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitE1) with Bacillus Subtilis ribosome binding site (RBS) infront of it. The RBS is there to allow the ribosomes to bind and start to translate the DNA. SubunitE1 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS, and the tetrary goal was to minimize the number of restriction sites. The amino acid sequence is based on the adapted MaSp2 sequences discribed in the paper of Brooks et. al. 2008. false false _1395_ 0 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339043 1 spidersilk subunit E2 range2339043 1 1 210 BBa_K1085038 1 BBa_K1085038 MotB Strep-tag SilkSubunitE1 SilkSubunitE2 2013-09-16T11:00:00Z 2015-05-08T01:09:05Z bla bla false false _1395_ 0 16089 9 It's complicated false bla false Mirjam Groenewold component2349197 1 BBa_K1085033 component2349199 1 BBa_K1085002 annotation2349197 1 BBa_K1085033 range2349197 1 1 378 annotation2349199 1 BBa_K1085002 range2349199 1 387 596 BBa_K1085033_sequence 1 atggcgagaaaaaagaagaagaagcatgaggacgagcacgttgatgaatcatggctcgttccttacgccgacatccttactcttctcctggcattgtttattgtgctgtacgcgagcagcggatcctggagccatccgcagtttgaaaaatccgcagcagcatccgcaggcggatacggaccaggagcaggccaacaaggcccaggctcacaaggcccaggctcaggcggacaacaaggaccaggcggacaaggcggctacggaccaggcgccggacaacaaggcccaggcagccaaggaccaggcagcggcggccaacaaggcccaggaggacaaggaccatacggcccaagcgcagcagccgcagcagccgcagcc BBa_K1085002_sequence 1 ggcggatacggcccaggcgcaggccaacaaggaccaggcagccaaggaccaggctcaggcggacaacaaggcccaggcggacaaggcggctacggcccaggcgccggacaacaaggaccaggctcacaaggaccaggctccggcggacaacaaggaccaggcggccaaggaccatacggaccaagcgcagcagccgcagcagccgccgca BBa_K1085038_sequence 1 atggcgagaaaaaagaagaagaagcatgaggacgagcacgttgatgaatcatggctcgttccttacgccgacatccttactcttctcctggcattgtttattgtgctgtacgcgagcagcggatcctggagccatccgcagtttgaaaaatccgcagcagcatccgcaggcggatacggaccaggagcaggccaacaaggcccaggctcacaaggcccaggctcaggcggacaacaaggaccaggcggacaaggcggctacggaccaggcgccggacaacaaggcccaggcagccaaggaccaggcagcggcggccaacaaggcccaggaggacaaggaccatacggcccaagcgcagcagccgcagcagccgcagcctactagagggcggatacggcccaggcgcaggccaacaaggaccaggcagccaaggaccaggctcaggcggacaacaaggcccaggcggacaaggcggctacggcccaggcgccggacaacaaggaccaggctcacaaggaccaggctccggcggacaacaaggaccaggcggccaaggaccatacggaccaagcgcagcagccgcagcagccgccgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z