BBa_K1085006 1 BBa_K1085006 SpiderSilkSubunitN2 2013-09-09T11:00:00Z 2016-02-10T01:07:20Z The amino acids sequence of the silk protein was obtained from MaSp2. The DNA sequence was synthesized by Integrated DNA Technologies (IDT). This BioBrick contains the coding sequence for part of the spider silk protein (SubunitN2). SubunitN2 codes for a spider silk protein that is optimized for maximal expression in Bacillus subtillus 168. The primary goal of the algorithm was to optimize the codon selection based on their availbility scores. The secondary goal was to minimize the number of restriction sites, and the tetrary goal was to prevent the formation of secondary RNA structures in close proximity to the RBS. false false _1395_ 0 4206 16089 9 In stock false The DNA sequence was codon-optimized for Bacillus Subtilis. Moreover the nucleotide sequence was optimized in order to accomplish the production standard of IDT. A couple of optimized codons were affected by this. false Claudio Tiecher annotation2339055 1 spidersilk subunit N2 range2339055 1 1 129 BBa_K1085040 1 BBa_K1085040 MotB Strep-tag SilkSubunitN1 SilkSubunitN2 2013-09-16T11:00:00Z 2016-02-10T11:30:48Z bla bla false false _1395_ 4206 16089 9 It's complicated false bla false Mirjam Groenewold component2349208 1 BBa_K1085006 component2349206 1 BBa_K1085034 annotation2349206 1 BBa_K1085034 range2349206 1 1 309 annotation2349208 1 BBa_K1085006 range2349208 1 318 446 BBa_K1085034 1 BBa_K1085034 MotB Strep-tag SilkSubunitN1 2013-09-16T11:00:00Z 2015-06-08T04:04:18Z Bla Bla false false _1395_ 4206 16089 9 In stock false Bla false Mirjam Groenewold annotation2367935 1 N1 range2367935 1 169 309 annotation2367933 1 Strep-tag range2367933 1 124 147 annotation2367932 1 SS-MotB range2367932 1 1 120 BBa_K1085040_sequence 1 atggcgagaaaaaagaagaagaagcatgaggacgagcacgttgatgaatcatggctcgttccttacgccgacatccttactcttctcctggcattgtttattgtgctgtacgcgagcagcggatcctggagccatccgcagtttgaaaaatccgcagcagcatccgcaccaggaggagccggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagcatactagagggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagca BBa_K1085006_sequence 1 ggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagca BBa_K1085034_sequence 1 atggcgagaaaaaagaagaagaagcatgaggacgagcacgttgatgaatcatggctcgttccttacgccgacatccttactcttctcctggcattgtttattgtgctgtacgcgagcagcggatcctggagccatccgcagtttgaaaaatccgcagcagcatccgcaccaggaggagccggctaccaaggaccaggcggctaccaaggaccatacggaccaggcggcggctacggaccaggcgcaggctaccaaggaccaggctcacaatacggaccaggctcagcagcagccgcagcagccgcagca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z