BBa_K1086000 1 BBa_K1086000 Promoter TorCAD (sensitive to TMAO) 2013-09-10T11:00:00Z 2015-05-08T01:09:06Z The source of this part is the genome of Escherichia coli (str. K-12 substr. MG1655), NCBI GI: 48994873. (Bordi et al. Mol. Micro. 2003) This part is promoter of the TorCAD operon from Escherichia coli, and its expression only happens in response to Trimethylamine N-oxide (TMAO). The TMAO is a organic compound with the formula (CH3)3NO, and it is a metabolite produced by the liver in humans, but in bacteria TMAO is used to produce energy in the absence of oxygen. The TMAO binds to TorT protein, which activates the TorS protein. The TorS protein phosphorilates the TorR transcriptional factor, which binds to TorCAD promoter, activating the transcription. false false _1396_ 0 16187 9 It's complicated false In order to have 125 nucleotides for synthesis by IDT-DNA we had to add 5 randomly nucleotides in the 5' end of the sequence right above EcoRI cutting site. false ??talo Faria do Valle BBa_K1086000_sequence 1 attctgttcatatctgttcatattccgttcatcctgaccagtgccgctgttcatatttgctcattaagatcgcttca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z