BBa_K1087004 1 BBa_K1087004 Ptet-Riboregulator(lock 3d) 2013-09-11T11:00:00Z 2015-05-08T01:09:06Z 3A assembly This is riboregulator that can express downstream gene with a key BBa_K145215, while "lock" it without the key.We assemblied this part as an alternative to BBa_I714070 which has a poor quality and cannot be transformed from the kit plate. false false _1397_ 0 12187 9 In stock false No false Tong Xu component2339160 1 BBa_J23032 component2339155 1 BBa_R0040 annotation2339160 1 BBa_J23032 range2339160 1 63 105 annotation2339155 1 BBa_R0040 range2339155 1 1 54 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 BBa_J23032 1 BBa_J23032 [lock3d] 2006-08-02T11:00:00Z 2015-08-31T04:08:39Z Extension of overlapping oligonucleotides lock3d false false _52_ 0 483 95 In stock false N/A true John Anderson BBa_K1087004_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaactagaatcacctcttgcttttgggtaagacagaagaggaga BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_J23032_sequence 1 aactagaatcacctcttgcttttgggtaagacagaagaggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z