BBa_K1087009 1 BBa_K1087009 Ptet-reverse lox-reverse PO promoter 2013-09-12T11:00:00Z 2015-05-08T01:09:06Z We first used PCR to add a lox site and reverse prefix/suffix to the PO promoter,then we assembly it with the Ptet This is one important part of the device K1087008. Reverse lox site is for recombination by Cre recombinase. PO promoter from P2 phage can be induced by activators such as BBa_I746352 false false _1397_ 0 12187 9 In stock false No false Tong Xu BBa_K1087009_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagataacttcgtatagcatacattatacgaagttatggcatcagtttcccgacgatgcgcatcctccgccatcagtcccggatggcttatcactgacacaacagcaccttagcgaatcgcggggcgcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z