BBa_K1087010 1 BBa_K1087010 T7 promoter-B0034 2013-09-12T11:00:00Z 2015-05-08T01:09:06Z 3A assembly Strong T7 promoter with strong RBS false false _1397_ 0 12187 9 It's complicated false No false Tong Xu component2339456 1 BBa_I712074 component2339458 1 BBa_B0034 annotation2339456 1 BBa_I712074 range2339456 1 1 46 annotation2339458 1 BBa_B0034 range2339458 1 55 66 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_B0034_sequence 1 aaagaggagaaa BBa_K1087010_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcatactagagaaagaggagaaa BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z