BBa_K1088001 1 BBa_K1088001 Dxs reporter system with constitutive promoter 2013-07-08T11:00:00Z 2015-05-08T01:09:06Z asd We constructed a system to quantify the protein expression of our desired gene, Dxs, by using the amilCP reporter. The system is under transcriptional control by a sigma 70 dependent promoter false false _1398_ 0 12807 9 In stock false asd false Andreas Kj??r annotation2330339 1 BBa_J23100 range2330339 1 1 35 BBa_K1088001_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z