BBa_K1088005 1 araC arabinose regulator (araC) coding sequence 2013-08-19T11:00:00Z 2015-05-08T01:09:06Z E. coli K-12 MG1655 This sequence is a copy of the sequence 70,387 -> 71,265 in E. coli K-12 MG1655 which is the coding sequence of the pBAD repressor araC. From ECOCYC: The "arabinose regulator," AraC, is a transcription factor that regulates transcription of several genes and operons involved in arabinose catabolism and transport. It coregulates with another transcriptional regulator, CRP; both are transcription factors involved in l-arabinose degradation. These regulators bind cooperatively to activate transcription of five operons related to transport, catabolism, and autoregulation of l-arabinose. Transcription of these operons is induced when E. coli is grown in the absence of glucose and when the physiological inducer, l-arabinose, binds to the AraC regulator. In the absence of glucose, cellular cyclic AMP levels are high and cyclic AMP forms a dimeric complex with CRP to coregulate with AraC. For more info go to http://ecocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG10054 false false _1398_ 0 12807 9 Not in stock false The part was amplified from chromosomal DNA with primers carrying prefix and suffix overhangs false Andreas Kj??r annotation2331909 1 araC coding region range2331909 1 1 879 BBa_K1088005_sequence 1 atggctgaagcgcaaaatgatcccctgctgccgggatactcgtttaacgcccatctggtggcgggtttaacgccgattgaggccaacggttatctcgatttttttatcgaccgaccgctgggaatgaaaggttatattctcaatctcaccattcgcggtcagggggtggtgaaaaatcagggacgagaatttgtctgccgaccgggtgatattttgctgttcccgccaggagagattcatcactacggtcgtcatccggaggctcgcgaatggtatcaccagtgggtttactttcgtccgcgcgcctactggcatgaatggcttaactggccgtcaatatttgccaatacgggtttctttcgcccggatgaagcgcaccagccgcatttcagcgacctgtttgggcaaatcattaacgccgggcaaggggaagggcgctattcggagctgctggcgataaatctgcttgagcaattgttactgcggcgcatggaagcgattaacgagtcgctccatccaccgatggataatcgggtacgcgaggcttgtcagtacatcagcgatcacctggcagacagcaattttgatatcgccagcgtcgcacagcatgtttgcttgtcgccgtcgcgtctgtcacatcttttccgccagcagttagggattagcgtcttaagctggcgcgaggaccaacgcattagtcaggcgaagctgcttttgagcactacccggatgcctatcgccaccgtcggtcgcaatgttggttttgacgatcaactctatttctcgcgagtatttaaaaaatgcaccggggccagcccgagcgagtttcgtgccggttgtgaagaaaaagtgaatgatgtagccgtcaagttgtcataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z