BBa_K1088020 1 BBa_K1088020 lacI:LVA device (constitutive promoter, RBS and terminator) 2013-09-16T11:00:00Z 2015-05-08T01:09:06Z The source of the part will be its components. The trancsriptional repressor lacI with LVA tag for faster degradation (BBa_C0012)under the constitutivly active promoter (BBa_J23106), with a RBS (BBa_B0030) and with a terminator (BBa_B1002). This device can be used to overexpress lacI with the purpose of repressing transcription from high-copy plasmids containting the lac promoter (BBa_R0010). The repression can be relieved by allosteric binding of IPTG to lacI, thereby promoting transcription from the lac promoter. false false _1398_ 0 17057 9 It's complicated false Used a strong terminator so that the composite part can be used in front of the lac promoter without unwanted transcription of the regulated gene. false Patrick Rosendahl Andreassen component2351532 1 BBa_B1002 component2351520 1 BBa_J23106 component2351524 1 BBa_K1088022 component2351527 1 BBa_K1088023 component2351522 1 BBa_B0030 annotation2351524 1 BBa_K1088022 range2351524 1 51 56 annotation2351520 1 BBa_J23106 range2351520 1 1 35 annotation2351527 1 BBa_K1088023 range2351527 1 57 1184 annotation2351522 1 BBa_B0030 range2351522 1 36 50 annotation2351532 1 BBa_B1002 range2351532 1 1185 1218 BBa_B1002 1 BBa_B1002 Terminator (artificial, small, %T~=85%) 2006-08-29T11:00:00Z 2015-08-31T04:07:21Z antiquity Artifical terminator, estimated %T~=85 false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 6 residues. true Haiyao Huang annotation1898412 1 B1002 range1898412 1 1 34 annotation1898414 1 Poly A tail range1898414 1 25 31 annotation1898415 1 Poly A tail range1898415 1 4 9 annotation1898413 1 stem loop range1898413 1 10 25 BBa_K1088023 1 lacI-LVA LacI-LVA (part C0012 without barcodes) 2013-09-16T11:00:00Z 2015-05-08T01:09:06Z represillator of Elowitz and Leibler (2000) See BBa_C0012 Coding region for the LacI protein with an LVA degradation tail and without an RBS. LacI binds to the pLac regulator BBa_R0010 and PLlac01 hybrid regulator BBa_R0011 and inhibits transcription. IPTG (Isopropylthiogalactoside) binds to LacI and inhibits its operation, therefore promoting transcription. A rapid degradation tail (LVA) has been added to improve the switch time for High to Low performance of this part. false false _1398_ 0 17057 9 Not in stock false Sequence taken from the repressilator of Elowitz and Leibler (2000). The obtained sequence was compared to the wild-type sequence for LacI obtained through a database search. The sequence had been modified from the wild-type in that wild-type GTG start was changed to an ATG start (note, actual ORF in E.coli has several GTG starts it would seem). The LVA tag has been added for quicker degradation. Incompatible with systems containing LacI, lactose, or IPTG. false Patrick Rosendahl Andreassen annotation2351491 1 LVA range2351491 1 1090 1128 annotation2351490 1 LacI-LVA range2351490 1 1 1128 BBa_K1088022 1 BBa_K1088022 TACTAG 2013-09-16T11:00:00Z 2015-05-08T01:09:06Z TACTAG Short DNA piece (TACTAG) false false _1398_ 0 17057 9 Not in stock false 6 random nucleotides false Patrick Rosendahl Andreassen BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_K1088020_sequence 1 tttacggctagctcagtcctaggtatagtgctagcattaaagaggagaaatactagatggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataacgcaaaaaaccccgcttcggcggggttttttcgc BBa_B1002_sequence 1 cgcaaaaaaccccgcttcggcggggttttttcgc BBa_K1088022_sequence 1 tactag BBa_B0030_sequence 1 attaaagaggagaaa BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_K1088023_sequence 1 atggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcaggctgcaaacgacgaaaactacgctttagtagcttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z