BBa_K1088051 1 Linker 10 aa linker with BamHI restriction site and TEV recognition site 2015-03-16T12:00:00Z 2015-05-08T01:09:06Z BBa_K105012 A flexible 10 amino acid linker that enables for functional protein/domain fusions. A BamHI site is included in order to prevent creation of a scarsite (in-frame scarsites encode stop-codons). Assembly of parts therefore has to be done with PCR amplification of inserts using appropriate primers instead of standard RFC[10] assembly of parts (see design page for further details). The encoded peptide (GSENLYFQSG) includes a recognition site for the TEV protease (ENLYFQS) that enables for seperation of the fused proteins/domains. false false _1398_ 0 17057 9 Not in stock false Using standard RFC[10] assembly of two parts creates scarsites (tactag). Transcription of the scarsite encodes: "uac uag" of which uag is a stop codon that would render the linker useless. Thus, standard assembly can not be employed for fusing proteins/domains. Instead we propose the following for implementing the linker: 1) Design primers for amplification of the C-terminal protein/domain that includes the linker DNA sequence in the primer a) Forward primer: 5'-cgctTCTAGaGGGATCCgaaaatttgtattttcaatctggtNNN...NNN-3' - includes XbaI-site, linker, and sequence complementary to DNA sequence of C-terminal protein/domain b) Reverse primer: 5'-atatCTGCAGCggccgctACTAGTaNNN...NNN-3' - includes PstI-site, SpeI-site and sequence complementary to DNA sequence of C-terminal protein/domain 2) PCR amplify BioBrick with the designed primers 3) digest pSB1C3 (or any other standard backbone) and amplified PCR product with XbaI and PstI 4) ligate digested pSB1C3 and PCR product to create brick with linker at the N-terminus (pSB1C3-Linker:C-terminal_protein/domain). 5) Design primers for amplification of the N-terminal protein/domain that includes BamHI-site a) Forward primer: 5'-cgctTCTAGAgNNN...NNN-3' - includes XbaI-site and sequence complementary to DNA sequence of N-terminal protein/domain b) Reverse primer: 5'-atatGGATCCNNN...NNN-3' - includes BamHI-site and sequence complementary to DNA sequence of N-terminal protein/domain (OBS! do NOT include stop-codons of coding sequences) 6) PCR amplify BioBrick with designed primer 7) digest pSB1C3-Linker:C-terminal_protein/domain and PCR product with XbaI and BamHI 8) ligate the digested pSB1C3-Linker:C-terminal_protein/domain and PCR product to create brick with protein/domain fused with the linker false Patrick Rosendahl Andreassen annotation2430563 1 BamHI-site range2430563 1 1 6 annotation2430564 1 TEV recognition-site range2430564 1 6 24 BBa_K1088051_sequence 1 ggatccgaaaatttgtattttcaatctggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z