BBa_K1091005 1 BBa_K1091005 pBAD-green fluorescent protein-SLOW 2013-09-17T11:00:00Z 2015-05-08T01:09:07Z It has an identical amino acid sequence with the wild type green fluorescent protein of Aequorea victoria. Part K1091005 is one of the CDS parts designed with the Transpeeder software version 1.0. Though it has an identical amino acid sequence with the wild type green fluorescent protein of Aequorea victoria, its nucleic sequence is designed to show more similarities with the Shine-Dalgarno sequence of E.coli via synonymous mutation using Transpeeder. The preliminary experimental results showed it had a slower translation speed than those of the wild type (K1091006) and fast parts (K1091004). Thus, the part is also called GFP-slow. Pay attention! This part is cloned in pBAD plasmid. false false _1401_ 0 16198 9 It's complicated false Its nucleic sequence is designed to show more similarities with the Shine-Dalgarno sequence of E.coli via synonymous mutation using the Transpeeder software version 1.0. false Jian Huang BBa_K1091005_sequence 1 atgagtaagggggaggagttatttacgggagttgtaccgatcttggtggagttggatggagatgttaacggtcataagtttagtgtgagtggggaaggtgaaggtgatgcaacgtatggtaagctgacgttgaagtttatatgtacgacaggtaagttgccggtaccgtggccgacgctggtaacgacgtttagttatggggtgcagtgttttagtaggtatccggatcacatgaagcagcacgatttttttaagagtgcaatgccggaaggttatgtacaggagaggacgatattttttaaggatgatggtaattataagacgagggcggaggtgaagtttgagggagatacgttggttaacaggattgagttaaaaggtatagattttaaggaggatggtaatatcttgggtcataagttggagtataattataatagtcataatgtgtatattatggcagataagcagaagaatggtatcaaggtgaattttaagataaggcataatattgaggatgggagtgtgcagttggcggatcattatcagcagaatacgccgataggtgatgggccggtactgctgccggataatcattatttgagtacgcagtcggcattgagtaaggatccgaatgagaagagggatcatatggtactgctggagtttgttacggcagctggtatcacgcatggtatggatgagttgtataagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z