BBa_K1093008 1 BBa_K1093008 sfGFP C-terminal (m12) 2013-09-19T11:00:00Z 2015-05-08T01:09:07Z oligo.pl (complementary oligonucleotides), originally from Aequorea victoria. This is C-terminal (m12) of sfGFP, created to Bimolecular Fluorescence Complementation (BiFC) system. It is from sfGFP, but works with other superfolder fluorescent proteins. false false _1403_ 0 18431 9 Not in stock false Complementary oligonucleotides. false Anna Miścicka annotation2357243 1 stop range2357243 1 50 52 annotation2357242 1 sfGFP C(m12) range2357242 1 1 54 BBa_K1093008_sequence 1 gatcatatggcggcgcatgaatatgtgaacgcggcgggcattaccattgattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z