BBa_K1093027 1 BBa_K1093027 bJun-RSIAT (Freiburg) 2013-09-22T11:00:00Z 2015-05-08T01:09:08Z The sequence was synthetized by GeneRay bJun domain with a linker at the C-terminus. Interacts with bFos (BBa_K1093026). Intended for measurement of split fluorophore parts. false false _1403_ 0 4695 9 Not in stock false The linker ensures proper folding of fused parts. bJun has been codon optimised for E. coli. false Jakub Piątkowski BBa_K1093027_sequence 1 atgaaagcggaacgcaaacgcatgcgcaaccgcattgcggcgagcaaatgccgcaaacgcaaactggaacgcattgcgcgcctggaagaaaaagtgaaaaccctgaaagcgcagaacagcgaactggcgagcaccgcgaacatgctgcgcgaacaggtggcgcagctgaaacagaaagtgatgaaccatgtgaacagcggctgccagctgatgctgacccagcagctgcaaacctttcgcagcattgcgaccaaacagaaagtgatgaaccatcgcagcattgcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z