BBa_K1093031 1 BBa_K1093031 HBB+CsfGFP m12 (+B0034) 2013-09-20T11:00:00Z 2015-05-08T01:09:08Z The sequence was synthetized by GeneRay Human hemoglobin beta chain fused at C-terminus with the C-terminal fragment of superfolder green fluorescent protein. m12 mutated version of the C-terminal sfGFP fragment offers larger specificity at the price of lowers sensitivity (as opposed to m6 vaersion) Along with BBa_K1093020 and BBa_K1093021 it is intended as a part of a reporter system for acrylamide detection. Formation of adducts on the N-terminal valine of both hemoglobin chains is known to inhibit proper assembly of hemoglobin tetramer. Part already contains a strong RBS (BBa_B0034). The coding sequence has been codon optimised for E. coli. false false _1403_ 0 4695 9 Not in stock false HBB and sfGFP are fused with a flexible linker BBa_K157009 false Jakub Piątkowski annotation2357363 1 B0034 range2357363 1 1 12 annotation2357368 1 stop range2357368 1 562 567 annotation2357369 1 B0010+B0012 range2357369 1 577 704 annotation2357364 1 HBB-CsfGFP (m12) range2357364 1 19 561 annotation2357366 1 start range2357366 1 19 21 BBa_K1093031_sequence 1 aaagaggagaaatactagatggtgcatctgaccccggaagaaaaaagcgcggtgaccgcgctgtggggcaaagtgaacgtggatgaagtgggcggcgaagcgctgggccgcctgctggtggtgtatccgtggacccagcgcttttttgaaagctttggcgatctgagcaccccggatgcggtgatgggcaacccgaaagtgaaagcgcatggcaaaaaagtgctgggcgcgtttagcgatggcctggcgcatctggataacctgaaaggcacctttgcgaccctgagcgaactgcattgcgataaactgcatgtggatccggaaaactttcgcctgctgggcaacgtgctggtgtgcgtgctggcgcatcattttggcaaagaatttaccccgccggtgcaggcggcgtatcagaaagtggtggcgggcgtggcgaacgcgctggcgcataaatatcatcgaccagcctgtaagattccaaatgacctgaagcagaaagttatgaatcacgatcatatggcggcgcatgaatatgtgaacgcggcgggcattaccattgattaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z