BBa_K1094000 1 BBa_K1094000 Enhanced flavin-binding fluorescent protein (eFbFP) 2013-09-02T11:00:00Z 2015-05-08T01:09:08Z Pseudomonas putida. Enhanced via F37S mutation. Originally described by: Arnab Mukherjee, Kevin B Weyant, Joshua Walker and Charles M Schroeder (2012): Directed evolution of bright mutants of an oxygen-independent flavin-binding fluorescent protein from Pseudomonas putida. J. Mol. Eng., 6:20. The reporter eFbFP is a fluorescent protein that uses flavin mono nucleotide (FMN) as a cofacter. The reporter is suitable for use in anaerobic conditions. Excitation can be done with 485nm and emission peak can be measured at 500nm. false false _1404_ 0 16234 9 In stock false Fluorescence is not easily spotted via fluorescence microscopy using GFP-filters. Thus, a 485nm filter is recommended. false Emil Christian Fischer BBa_K1094000_sequence 1 atgatcaacgccaagctgctccagctgatggtcgagcacagcaacgacgggatcgtcgtggcggagcaggagggcaacgagtccatcctgatctacgtgaatcccgcctccgaacgcctcaccggctattgcgccgatgacatcctgtatcaggactgccgcttcctccagggcgaggaccatgaccagccggggatcgcgatcatccgcgaagccatccgcgaaggccgtccctgttgccaggtgttgcggaactatcgcaaggacggctcgctgttctggaacgagctgtccatcaccccggtgcacaatgaggcggatcagctgacctactacatcggcattcagcgggatgtcacggcccaggtgttcgccgaagagcgcgttcgcgaactggaggccgaagtcgccgagttgcgtcgtcagcaagggcaggccaagcattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z