BBa_K1100009 1 BBa_K1100009 Csy4 generator with no terminator 2013-09-12T11:00:00Z 2015-05-08T01:09:08Z The Csy4 part is modified from the plasmid pHMGWA-Pa14Csy4 made by Jennifer Doudna's Lab. Csy4 is a member of CRISPR pathway discovered in Pseudomonas aeruginosa. It is a single endoRNase that recognizes and cleaves a 28-nucleotide repetitive sequence and produces stable transcripts with a 5???hydroxylgroup, which can eliminate unwanted interactions between 5???UTRs and translational elements such as RBSs to standardize the expression of the elements. false false _1410_ 0 14489 9 In stock false There is no terminator here. Therefore, it can be add upstream of any terminator you are interested in. With a sfGFP reporter with a insulator -- the 16nt Csy4 cleavage loci, you can estimate how downstream sequence influences the terminator efficiency, like the study we did with the part BBa_K1100011. false YingQi Lou annotation2339624 1 TetR 1 range2339624 1 1 19 annotation2339623 1 BBa_R0040 range2339623 1 1 54 annotation2339625 1 -35 range2339625 1 20 25 annotation2339627 1 B0034 range2339627 1 79 89 annotation2339628 1 Insulator: Csy4 cleavage loci range2339628 1 62 77 annotation2339626 1 -10 range2339626 1 43 48 annotation2339629 1 Csy4 range2339629 1 96 659 BBa_K1100009_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagactgccgtataggcagcaaagaggagaaatactagatggaccactacctcgacattcgcttgcgaccggacccggaatttcccccggcgcaactcatgagcgtgctcttcggcaagctccaccaggccctggtggcacagggcggggacaggatcggcgtgagcttccccgacctcgacgaaagccgctcccggctgggcgagcgcctgcgcattcatgcctcggcggacgaccttcgtgccctgctcgcccggccctggctggaagggttgcgggaccatctgcaattcggagaaccggcagtcgtgcctcaccccacaccgtaccgtcaggtcagtcgggttcaggcgaaaagcaatccggaacgcctgcggcggcggctcatgcgccggcacgatctgagtgaggaggaggctcggaaacgcattcccgatacggtcgcgagagccttggacctgcccttcgtcacgctacgcagccagagcaccggacagcacttccgtctcttcatccgccacgggccgttgcaggtgacggcagaggaaggaggattcacctgttacgggttgagcaaaggaggtttcgttccctggttctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z