BBa_K1100010 1 BBa_K1100010 Csy4 generator (with terminator) 2013-09-12T11:00:00Z 2015-05-08T01:09:08Z The Csy4 part is modified from the plasmid pHMGWA-Pa14Csy4 made by Jennifer Doudna's Lab. R0040-csy4 insulator-B0034-Csy4-B0015 false false _1410_ 0 14489 9 It's complicated false To generate Csy4 protein false YingQi Lou component2339644 1 BBa_B0015 component2339637 1 BBa_K1100009 annotation2339644 1 BBa_B0015 range2339644 1 668 796 annotation2339637 1 BBa_K1100009 range2339637 1 1 659 BBa_K1100009 1 BBa_K1100009 Csy4 generator with no terminator 2013-09-12T11:00:00Z 2015-05-08T01:09:08Z The Csy4 part is modified from the plasmid pHMGWA-Pa14Csy4 made by Jennifer Doudna's Lab. Csy4 is a member of CRISPR pathway discovered in Pseudomonas aeruginosa. It is a single endoRNase that recognizes and cleaves a 28-nucleotide repetitive sequence and produces stable transcripts with a 5???hydroxylgroup, which can eliminate unwanted interactions between 5???UTRs and translational elements such as RBSs to standardize the expression of the elements. false false _1410_ 0 14489 9 In stock false There is no terminator here. Therefore, it can be add upstream of any terminator you are interested in. With a sfGFP reporter with a insulator -- the 16nt Csy4 cleavage loci, you can estimate how downstream sequence influences the terminator efficiency, like the study we did with the part BBa_K1100011. false YingQi Lou annotation2339625 1 -35 range2339625 1 20 25 annotation2339629 1 Csy4 range2339629 1 96 659 annotation2339627 1 B0034 range2339627 1 79 89 annotation2339628 1 Insulator: Csy4 cleavage loci range2339628 1 62 77 annotation2339623 1 BBa_R0040 range2339623 1 1 54 annotation2339624 1 TetR 1 range2339624 1 1 19 annotation2339626 1 -10 range2339626 1 43 48 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1100010_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagactgccgtataggcagcaaagaggagaaatactagatggaccactacctcgacattcgcttgcgaccggacccggaatttcccccggcgcaactcatgagcgtgctcttcggcaagctccaccaggccctggtggcacagggcggggacaggatcggcgtgagcttccccgacctcgacgaaagccgctcccggctgggcgagcgcctgcgcattcatgcctcggcggacgaccttcgtgccctgctcgcccggccctggctggaagggttgcgggaccatctgcaattcggagaaccggcagtcgtgcctcaccccacaccgtaccgtcaggtcagtcgggttcaggcgaaaagcaatccggaacgcctgcggcggcggctcatgcgccggcacgatctgagtgaggaggaggctcggaaacgcattcccgatacggtcgcgagagccttggacctgcccttcgtcacgctacgcagccagagcaccggacagcacttccgtctcttcatccgccacgggccgttgcaggtgacggcagaggaaggaggattcacctgttacgggttgagcaaaggaggtttcgttccctggttctgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1100009_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagactgccgtataggcagcaaagaggagaaatactagatggaccactacctcgacattcgcttgcgaccggacccggaatttcccccggcgcaactcatgagcgtgctcttcggcaagctccaccaggccctggtggcacagggcggggacaggatcggcgtgagcttccccgacctcgacgaaagccgctcccggctgggcgagcgcctgcgcattcatgcctcggcggacgaccttcgtgccctgctcgcccggccctggctggaagggttgcgggaccatctgcaattcggagaaccggcagtcgtgcctcaccccacaccgtaccgtcaggtcagtcgggttcaggcgaaaagcaatccggaacgcctgcggcggcggctcatgcgccggcacgatctgagtgaggaggaggctcggaaacgcattcccgatacggtcgcgagagccttggacctgcccttcgtcacgctacgcagccagagcaccggacagcacttccgtctcttcatccgccacgggccgttgcaggtgacggcagaggaaggaggattcacctgttacgggttgagcaaaggaggtttcgttccctggttctga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z