BBa_K1100063 1 BBa_K1100063 RNA-OUT S5 2013-09-12T11:00:00Z 2015-05-08T01:09:08Z coming soon coming soon false false _1410_ 0 14489 9 It's complicated false coming soon false Hao-tian Guo annotation2356213 1 RNA-IN S5 range2356213 1 2 116 BBa_R1051 1 cI lam Promoter, Standard (lambda cI regulated)<br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <a href="http://www.nature.com/cgi-taf/DynaPage.taf?file=/nature/journal/v403/n6767/abs/403335a0_fs.html&dynoptions=doi1043774228">A synthetic oscillatory network of transcriptional regulators</a> , Elowitz M.B. , Leibler S., Nature(403),335-38: 2000 Released HQ 2013 [Note: This is the same part as R0051 except that the -10 and -35 sites and spacing have been changed to comply with BBa_S0001].<br><br>The cI regulated promoter is based on the pR promtoer from bacteriohage lambda. The promoter has two two DNA binding sites for lambda cI repressor <bb_part>BBa_C0051</bb_part>. cI binding results in repression of transcription. The specific sequence used here is based on the cI repressible promoter used in the Elowitz repressilator (and references therein).</P> false false _1_ 0 24 7 In stock false <P> <P>In order to address concerns about the promoter transcribing in the reverse direction, we have removed the -35 and -10 signals responsible for the promoter activity in the reverse direction. (<b><font color="red">More details needed here! DE, 2/24/03</font></b>)<br><br> Modified to comply with BBa_S0001:<br> TTGACA-17N-GATACT<br><P> Incompatible with host expressing cI repressor. true Vinay S Mahajan, Brian Chow, Peter Carr, Voichita Marinescu and Alexander D. Wissner-Gross<br> Drew Endy<br> annotation2076 1 OR1 range2076 1 25 41 annotation2075 1 -35 range2075 1 15 20 annotation7074 1 BBa_R1051 range7074 1 1 49 annotation2077 1 OR2 range2077 1 1 17 annotation2078 1 -10 range2078 1 38 43 BBa_K1100013 1 BBa_K1100013 R1051-OUT S1 2013-09-12T11:00:00Z 2015-05-08T01:09:08Z coming soon coming soon false false _1410_ 0 14489 9 It's complicated false coming soon false Shuqi Du component2355979 1 BBa_R1051 component2355983 1 BBa_K1100063 annotation2355979 1 BBa_R1051 range2355979 1 1 49 annotation2355983 1 BBa_K1100063 range2355983 1 58 174 BBa_R1051_sequence 1 taacaccgtgcgtgttgacaattttacctctggcggtgatactggttgc BBa_K1100063_sequence 1 gtcgcacatcttgttgtctgattattgattttacgcgaaaccatttgatcatatgacaagatgtgtatccaccttaacttaatgatttttaccaaaatcattaggggattcatcagt BBa_K1100013_sequence 1 taacaccgtgcgtgttgacaattttacctctggcggtgatactggttgctactagaggtcgcacatcttgttgtctgattattgattttacgcgaaaccatttgatcatatgacaagatgtgtatccaccttaacttaatgatttttaccaaaatcattaggggattcatcagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z