BBa_R0063 1 lux pL Promoter (luxR & HSL regulated -- lux pL)<br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri.</em> Released HQ 2013 The lux cassette of V. fischeri contains a left and a right promoter. The left promoter gives weak constitutive expression of downstream genes.This expression is down-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription from Pr, repressing transcription from Pl</p> false true _1_ 0 24 7 In stock false <P> <P> This promoter is based on the Vibrio fischeri quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below.Includes most of Lux reulatory region, including the LuxR binding site which activates the right promoter. A putative LuxR autorepression binding site is also identified adjacent to the -10 site of the right promoter. This 2nd site has 55% identity with the first site. Putative inverted repeats (of size 18-27 bp) also exist between these two sites (not marked above), which may represent binding sites for other regulatory proteins. <p><img src="<bb_file>Image01.gif</bb_file>" width="614" height="362"><P>Unspecified. true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation2055 1 Putative LuxR/HSL range2055 1 130 149 annotation2051 1 LuxR/HSL range2051 1 1 20 annotation7071 1 BBa_R0063 range7071 1 1 151 annotation2053 1 -35 range2053 1 89 94 annotation2052 1 -10 range2052 1 115 122 annotation2054 1 start range2054 1 128 128 BBa_K1100006 1 BBa_K1100006 optimized sfGFP with Csy4 insulator loci 2013-09-12T11:00:00Z 2015-05-08T01:09:08Z The Csy4 part is modified from the plasmid pHMGWA-Pa14Csy4 made by Jennifer Doudna's Lab. Csy4 is a member of CRISPR pathway discovered in Pseudomonas aeruginosa. It is a single endoRNase that recognizes and cleaves a 28-nucleotide repetitive sequence and produces stable transcripts with a 5???hydroxylgroup, which can eliminate unwanted interactions between 5???UTRs and translational elements such as RBSs to standardize the expression of the elements. false false _1410_ 0 14489 9 Not in stock false Csy4 is a protein used to cleavage the mRNA so that the influence from UTR will be eliminated false Hao-tian Guo annotation2339688 1 sfGFP range2339688 1 41 739 annotation2339687 1 B0034 range2339687 1 22 34 annotation2339478 1 insulator: Csy4 cleavage loci range2339478 1 7 22 BBa_K1100017 1 BBa_K1100017 R0063 with insulator and sfGFP 2013-09-12T11:00:00Z 2015-05-08T01:09:08Z coming soon coming soon false false _1410_ 0 14489 9 It's complicated false coming soon false Chenxi He, Jiadong Ni component2341165 1 BBa_K1100006 component2341157 1 BBa_R0063 annotation2341165 1 BBa_K1100006 range2341165 1 160 892 annotation2341157 1 BBa_R0063 range2341157 1 1 151 BBa_R0063_sequence 1 acctgtacgatcctacaggtgcttatgttaagtaattgtattcccagcgatacaatagtgtgacaaaaatccaatttattagaatcaaatgtcaatccattaccgttttaatgatatataacacgcaaaacttgcgacaaacaataggtaa BBa_K1100017_sequence 1 acctgtacgatcctacaggtgcttatgttaagtaattgtattcccagcgatacaatagtgtgacaaaaatccaatttattagaatcaaatgtcaatccattaccgttttaatgatatataacacgcaaaacttgcgacaaacaataggtaatactagagctgccgtataggcagcaaagaggagaaatactagatgagcaaaggcgaagaactgtttaccggcgtggtgccgattctggttgaactggatggcgatgttaatggccataagtttagcgtgcgcggcgaaggcgaaggcgatgcgaccaacggcaaactgaccctgaagtttatttgcaccaccggcaaactgccggtgccgtggccgaccctggtgaccaccctgacctatggcgtgcagtgctttagccgctatccggatcacatgaaacgccatgatttctttaagtccgcgatgccggaaggctatgttcaggaacgcaccattagctttaaagatgatggcacctataagacccgcgcggaagtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcattgacttcaaagaagatggcaacattctgggccataaactggagtacaatttcaacagccataacgtgtatattaccgcggacaaacagaagaacggcatcaaagcgaatttcaaaatccgccataatgtggaagatggcagcgtgcagctggcggatcactatcagcagaataccccgatcggcgatggcccggtgctgctgccggacaatcactacctgagcacccagtccgtgctgagcaaagatccgaatgagaaacgcgatcacatggttctgctggagtttgtgaccgcggcgggtatcactcatggctaa BBa_K1100006_sequence 1 ctgccgtataggcagcaaagaggagaaatactagatgagcaaaggcgaagaactgtttaccggcgtggtgccgattctggttgaactggatggcgatgttaatggccataagtttagcgtgcgcggcgaaggcgaaggcgatgcgaccaacggcaaactgaccctgaagtttatttgcaccaccggcaaactgccggtgccgtggccgaccctggtgaccaccctgacctatggcgtgcagtgctttagccgctatccggatcacatgaaacgccatgatttctttaagtccgcgatgccggaaggctatgttcaggaacgcaccattagctttaaagatgatggcacctataagacccgcgcggaagtgaaatttgaaggcgataccctggtgaaccgcattgaactgaaaggcattgacttcaaagaagatggcaacattctgggccataaactggagtacaatttcaacagccataacgtgtatattaccgcggacaaacagaagaacggcatcaaagcgaatttcaaaatccgccataatgtggaagatggcagcgtgcagctggcggatcactatcagcagaataccccgatcggcgatggcccggtgctgctgccggacaatcactacctgagcacccagtccgtgctgagcaaagatccgaatgagaaacgcgatcacatggttctgctggagtttgtgaccgcggcgggtatcactcatggctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z