BBa_K1100021 1 BBa_K1100021 R0040-Aleader 2013-10-25T11:00:00Z 2015-05-08T01:09:08Z coming soon coming soon false false _1410_ 0 16163 9 It's complicated false coming soon false Yanwei Cai component2370841 1 BBa_K1100000 component2370830 1 BBa_R0040 annotation2370841 1 BBa_K1100000 range2370841 1 63 137 annotation2370830 1 BBa_R0040 range2370830 1 1 54 BBa_K1100000 1 ALeader ALeader 2013-09-12T11:00:00Z 2015-05-08T01:09:08Z coming soon coming soon false false _1410_ 0 14489 9 It's complicated true coming soon false Hao-tian Guo annotation2341353 1 SD1 range2341353 1 1 4 annotation2354810 1 ATG range2354810 1 13 15 annotation2341355 1 antiSD range2341355 1 66 69 annotation2341356 1 ATG range2341356 1 73 75 annotation2354811 1 ORF11 range2354811 1 16 51 annotation2341354 1 SD2 range2341354 1 59 62 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986783 1 TetR 1 range1986783 1 1 19 BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K1100000_sequence 1 ggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaggcagcacggagacacttcagcatg BBa_K1100021_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaggcagcacggagacacttcagcatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z