BBa_K1100000 1 ALeader ALeader 2013-09-12T11:00:00Z 2015-05-08T01:09:08Z coming soon coming soon false false _1410_ 0 14489 9 It's complicated true coming soon false Hao-tian Guo annotation2341356 1 ATG range2341356 1 73 75 annotation2354811 1 ORF11 range2354811 1 16 51 annotation2354810 1 ATG range2354810 1 13 15 annotation2341355 1 antiSD range2341355 1 66 69 annotation2341353 1 SD1 range2341353 1 1 4 annotation2341354 1 SD2 range2341354 1 59 62 BBa_K1100022 1 BBa_K1100022 R0063-ALeader 2013-09-26T11:00:00Z 2015-05-08T01:09:08Z Coming soon Coming soon false false _1410_ 0 18288 9 It's complicated false Coming soon false Chenxi He component2364923 1 BBa_K1100000 component2364912 1 BBa_R0063 annotation2364923 1 BBa_K1100000 range2364923 1 160 234 annotation2364912 1 BBa_R0063 range2364912 1 1 151 BBa_R0063 1 lux pL Promoter (luxR & HSL regulated -- lux pL)<br> 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri.</em> Released HQ 2013 The lux cassette of V. fischeri contains a left and a right promoter. The left promoter gives weak constitutive expression of downstream genes.This expression is down-regulated by the action of the Lux repressor, LuxR. Two molecules of LuxR protein form a complex with two molecules the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription from Pr, repressing transcription from Pl</p> false true _1_ 0 24 7 In stock false <P> <P> This promoter is based on the Vibrio fischeri quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below.Includes most of Lux reulatory region, including the LuxR binding site which activates the right promoter. A putative LuxR autorepression binding site is also identified adjacent to the -10 site of the right promoter. This 2nd site has 55% identity with the first site. Putative inverted repeats (of size 18-27 bp) also exist between these two sites (not marked above), which may represent binding sites for other regulatory proteins. <p><img src="<bb_file>Image01.gif</bb_file>" width="614" height="362"><P>Unspecified. true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation2051 1 LuxR/HSL range2051 1 1 20 annotation2053 1 -35 range2053 1 89 94 annotation7071 1 BBa_R0063 range7071 1 1 151 annotation2055 1 Putative LuxR/HSL range2055 1 130 149 annotation2054 1 start range2054 1 128 128 annotation2052 1 -10 range2052 1 115 122 BBa_K1100022_sequence 1 acctgtacgatcctacaggtgcttatgttaagtaattgtattcccagcgatacaatagtgtgacaaaaatccaatttattagaatcaaatgtcaatccattaccgttttaatgatatataacacgcaaaacttgcgacaaacaataggtaatactagagggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaggcagcacggagacacttcagcatg BBa_R0063_sequence 1 acctgtacgatcctacaggtgcttatgttaagtaattgtattcccagcgatacaatagtgtgacaaaaatccaatttattagaatcaaatgtcaatccattaccgttttaatgatatataacacgcaaaacttgcgacaaacaataggtaa BBa_K1100000_sequence 1 ggagcagcaacgatgttacgcagcagggcagtcgccctaaaacaaagttaggcagcacggagacacttcagcatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z