BBa_K1100071 1 BBa_K1100071 RNA-IN S1 2013-09-12T11:00:00Z 2015-05-08T01:09:09Z coming soon coming soon false false _1410_ 0 14489 9 Not in stock false coming soon false Hao-tian Guo annotation2356221 1 ATG range2356221 1 29 31 annotation2356225 1 GGAG range2356225 1 17 20 BBa_K1100071_sequence 1 ggcgaaaaatcaataaggagacaacaagatgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z