BBa_K1100075 1 BBa_K1100075 RNA-IN S34 2013-09-12T11:00:00Z 2015-05-08T01:09:09Z coming soon coming soon false false _1410_ 0 14489 9 Not in stock false coming soon false Hao-tian Guo annotation2356247 1 ATG range2356247 1 29 31 annotation2356246 1 GGAG range2356246 1 17 20 BBa_K1100075_sequence 1 gccccgaaaaatcaataaggagacaacaagatgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z