BBa_K1100076 1 BBa_K1100076 RNA-IN S49 2013-09-12T11:00:00Z 2015-05-08T01:09:09Z coming soon coming soon false false _1410_ 0 14489 9 Not in stock false coming soon false Hao-tian Guo annotation2356248 1 GGAG range2356248 1 17 20 annotation2356249 1 ATG range2356249 1 29 31 BBa_K1100076_sequence 1 gccccgaaaaatcaataaggagacaacaagatgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z