BBa_K110008 1 BBa_K110008 A-Cell Promoter MFA1 2008-05-29T11:00:00Z 2015-05-08T01:09:09Z SGD This promoter was isolated by taking 500bp upstream of the MFA1 gene of S. cerevisiae. This promoter will be activated when A factor is expressed in an A haploid yeast cell. false false _201_ 0 2669 9 Not in stock false This gene is on the Watson strand of the entered sequence. false James DiCarlo annotation1981090 1 STE12 range1981090 1 302 309 annotation1981089 1 MATalpha2 range1981089 1 289 297 annotation1981087 1 MATalpha2 range1981087 1 267 276 annotation1981088 1 MCM1 range1981088 1 277 287 annotation1981086 1 MFA1 Promoter range1981086 1 1 501 BBa_K110008_sequence 1 aagaatttattgcgtctgggttcaacactaattatgcgtacgaaagggtgttgacagaggcatttatgggcttaggatgtgttatatccgaggagctttaaaacatcaggatagtgtgcaacgtggcataagctatgtaatcaactactttttattttctatgtacgcatatacatgcattcacgatctgtttcagtgttcagaaaaaaggcacctactgctacggttggcccatacctttattctttgttcttgttacaaacgagtgtgtaattacccaaaaaggaaatttacatgttaaatgaaacccagtaatcagaaaaaacagttaagaaacctaaaatggtagagataaagatacagattcagtggttgctgaaaatcaagtaaaaaaatgaaatagagtcttcatatataaaccgccagaaatgaattaatgagagggatctgtaactgtttctcggataaaaccaaaataagtacaaagccatcgaatagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z