BBa_K110009 1 BBa_K110009 A-Cell Promoter STE2 2008-05-29T11:00:00Z 2015-05-08T01:09:09Z SGD This promoter was isolated by taking 500bp upstream of the MFA1 gene of S. cerevisiae. This promoter will be activated when A factor is expressed in an A haploid yeast cell. false false _201_ 0 2669 9 Not in stock false This promotor is on the crick strand of the entered sequence. false Rick Carrick, Ambhi Ganesan, Alex McMillan annotation1981501 1 Mat Alpha2 range1981501 1 295 301 annotation1981499 1 Mat Alpha2 range1981499 1 273 280 annotation1981502 1 STE12 range1981502 1 304 312 annotation1981500 1 MCM1 range1981500 1 283 292 annotation1981498 1 Ste2 Promoter range1981498 1 1 501 BBa_K110009_sequence 1 agaacgaactgtagaatagtccggatatgttatccaatgcctgccaaaatgcattgtcacacgctgtagtgctcgaataggtgttgcaatccgtcaatatacgtcttgctctgtgggtaaatgtctcgtgcattaagacaggctagtataaacgagaagaagtatcctgctttgcaatgaaacaatagtatccgctaagaatttaagcaggccaacgtccatactgcttaggacctgtgcctggcaagtcgcagattgaagttttttcaaccatgtaaatttcctaattgggtaagtacatgatgaaacacatatgaagaaaaaagctttcctacatattcaagatttttttctgtgggtggaatactatttaaggagtgctattagtatcttatttgacttcaaagcaatacgataccttttcttttcacctgctctggctataattataattggttacttaaaaatgcaccgttaagaaccatatccaagaatcaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z