BBa_K110012 1 BBa_K110012 STE2 terminator 2008-08-26T11:00:00Z 2015-05-08T01:09:09Z SGD This is the exact region between the end of the ORF of STE2-W and the beginning of BST1-C false false _201_ 0 2669 9 Not in stock false This sequence was taken from the yeast genome false James DiCarlo annotation1994877 1 Terminator range1994877 1 1 123 BBa_K110012_sequence 1 atcaaaatttacggctttgaaaaagtaatttcgtgaccttcggtataaggttactactagattcaggtgctcatcagatgcaccacattctctataaaaaaaaatggtatctttcttatttga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z