BBa_K1104201 1 BBa_K1104201 TrxC promoter 2013-09-10T11:00:00Z 2015-05-08T01:09:09Z E. coli MG1655 genomic sequence TrxC promoter is controlled by OxyR (transcription factor), which is activated by ROS(Reactive Oxygen Species). A disulfide bond will form between 2 OxyR transcription factors to activate the transcription. false false _1415_ 0 16313 9 In stock true . false Ting-Yun Chiang annotation2365109 1 -35 range2365109 1 43 48 annotation2365108 1 OxyR binding site2 range2365108 1 33 49 annotation2365110 1 -10 range2365110 1 65 70 annotation2365107 1 OxyR binding site1 range2365107 1 11 27 BBa_K1104201_sequence 1 ccaaagcctgcgactatcatacctattgaataaaacagattgttgtctggaacaatgtccccgataatatgtaacatattagaaacataccggcgtcgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z