BBa_K1104202 1 BBa_K1104202 HemH promoter 2013-09-10T11:00:00Z 2015-05-08T01:09:09Z E. coli MG1655 genomic sequence HemH promoter is controlled by OxyR (transcription factor), which is activated by ROS(Reactive Oxygen Species). A disulfide bond will form between 2 OxyR transcription factors to activate the transcription. false false _1415_ 0 16313 9 In stock false . false Ting-Yun Chiang annotation2365129 1 -35 range2365129 1 35 40 annotation2365128 1 OxyR binding site2 range2365128 1 33 49 annotation2365130 1 -10 range2365130 1 61 66 annotation2365127 1 OxyR binding site1 range2365127 1 11 27 BBa_K1104202_sequence 1 ctattcctttttctgatttgacctctcacagcaattagttcttcttcctcacttttccgctacaattatcaacaagttgaatcgataagaggcggtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z