BBa_K1104205 1 BBa_K1104205 AhpCp2 2013-09-15T11:00:00Z 2015-05-08T01:09:09Z ''E. coli MG1655'' genomic sequence We improve the function of a BioBrick Part: AhpC promoter([http://parts.igem.org/Part:BBa_K362001 K362001])designed by [http://2010.igem.org/Team:KIT-Kyoto/Parts 2010 KIT-Tokyo team] into four versions.On PartRegistry, the complex part(according to [http://ecocyc.org/ECOLI/new-image?object=EG11384 Ecocyc]) composition contains hybrid promoters(AhpC1, AhpC2, and DsbG promoter), shared TFBS (Transcription Factor Binding Site), and reverse promoter DsbG. There is only AhpC2 promoter in this part. We designed the new part and test the promoter alone. false false _1415_ 0 16313 9 In stock false Because AhpC promoter([http://parts.igem.org/Part:BBa_K362001 K362001]) on PartRegistry is a hybrid promoter containing AhpC1, AhpC2, and DsbG promoter in its 1000bp, we design the new part: AhpC2 and test it apart. false Ting-Yun Chiang annotation2365195 1 OxyR binding site1 range2365195 1 118 134 annotation2365197 1 (AhpCp2)-35 range2365197 1 166 171 annotation2365198 1 (AhpCp2)-10 range2365198 1 192 197 annotation2365196 1 OxyR binding site2 range2365196 1 141 157 BBa_K1104205_sequence 1 caatcgcttttactggagcaggaagttcctctgcgaaggcgattgcaggaagcagagccagtaaaagtatcttttttaacattaatttgtccttttcagtcagtgcaaaagtcgagtaaaaggcataacctatcactgtcataggtaagagcttagatcaggtgattgccctttgtttatgagggtgttgtaatccatgtcgttgttgcatttgtaagggcaacac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z