BBa_K1104206 1 BBa_K1104206 AhpCpD1 2013-09-15T11:00:00Z 2015-05-08T01:09:09Z ''E. coli MG1655'' genomic sequence :We improve the function of a BioBrick Part: AhpC promoter([http://parts.igem.org/Part:BBa_K362001 K362001])designed by [http://2010.igem.org/Team:KIT-Kyoto/Parts 2010 KIT-Tokyo team] into four versions.On PartRegistry, the complex part(according to [http://ecocyc.org/ECOLI/new-image?object=EG11384 Ecocyc]) composition contains hybrid promoters, shared TFBS (Transcription Factor Binding Site), and reverse promoter DsbG. :OxyR binding to the ahpC-proximal site leads to the induction of both dsbG and ahpC transcripts, while OxyR binding to the dsbG-proximal site leads to the induction of a second ahpC transcript. This transcript of ahpC and the transcript of dsbG overlap by over 100 nucleotides. :The intergenic region between dsbG and ahpC carries two binding sites for OxyR, a dsbG-proximal site, located 54 bp upstream of the dsbG start codon, and an ahpC-proximal site, located 290 bp upstream of the dsbG start codon. false false _1415_ 0 16313 9 In stock false . false Ting-Yun Chiang annotation2365205 1 OxyR binding site4 range2365205 1 94 110 annotation2365207 1 (AhpCp1)-10 range2365207 1 133 138 annotation2365204 1 OxyR binding site3 range2365204 1 72 88 annotation2365206 1 (AhpCp1)-35 range2365206 1 109 114 annotation2365208 1 DsbGp range2365208 1 1 25 BBa_K1104206_sequence 1 tggaaagggggccattttactttttatcgccgctggcggtgcaaagttcacaaagttgtcttacgaaggttgtaaggtaaaacttatcgatttgataatggaaacgcattagccgaatcggcaaaaattggttaccttacatctcatcgaaaacacggaggaagtatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z